|
|
| 1 |
GPL4 |
SAGE:10:NlaIII:Homo sapiens |
801,451 |
|
2000-09-28 |
|
Homo sapiens
 |
SAGE NlaIII |
SAGE NlaIII, SAGE:10:NlaIII:Homo sapiens, |
| 2 |
GPL6 |
SAGE:10:Sau3A:Homo sapiens |
107,099 |
|
2001-01-04 |
|
Homo sapiens
|
SAGE Sau3A |
SAGE Sau3A, SAGE:10:Sau3A:Homo sapiens, |
| 3 |
GPL7 |
NHGRI_Human_8K |
8,192 |
NHGRI, NIH |
2001-01-08 |
|
Homo sapiens
|
cDNA Array |
spotted DNA/cDNA, NHGRI_Human_8K, The 8,150 human cDNAs used in this microarray were obtained under a Cooperative Research and Development Agreement with Research Genetics and 6,912 were verifed by sequence. This set of cDNAs is part of a larger collection (http://www.nhgri.nih.gov/DIR/Microarray/main.html). On the basis of the UniGene build of 9 March 2000, the 8,150 cDNAs represent 6,971 unique genes in this array. All clones were confirmed by resequencing if necessary. |
| 4 |
GPL10 |
Human Unigene I, part 2 |
36,864 |
German Cancer Research Center |
2001-05-30 |
|
Homo sapiens
|
cDNA Array |
spotted DNA/cDNA, Human Unigene I, part 2, Human cDNA filter from the Resource Centre of the German Human Genome Project. Each of the two parts (GPL9 and GPL10) contains half of 31,488 PCR amplificates of human cDNAs selected as representatives of UniGene clusters (Build #17, NCBI). Selection of a Global Human Clone Set: In order to generate a non-redundant human clone set, we postprocessed the UniGene clusters (Build 17, NCBI), which represent a large number of human genes. All processing steps are part of the GeneNest software (Haas et al., 2000), that additionally provides an interactive graphical interface to the postprocessed UniGene database (http://www.dkfz.de/tbi/services/GeneNest/index). To identify the most reliable, representative clone from each cluster, we analyzed the following criteria (sorted according to their importance): (1) Availability of clones at the RZPD. (2) Quality of cDNA library of origin. (3) Presence of more than one read of the same clone in a cluster, ensuring a higher confidence in the sequence - clone relationship. (4) Calculated insert size, selecting for larger inserts. (5) Presence of a polyA signal. We used a fuzzy logic based rule system to combine all clone selection criteria in order to obtain a quality measure of each clone in the entire UniGene set. For each cluster we selected the clone with the highest quality as representative. To estimate the redundancy of the global clone set, we re-sequenced over 2,700 clones of the set and found 12.8% wrongly assigned clones. All of these belonged to clusters that were already represented by another clone. Therefore, the overall redundancy of the clone set was estimated to be 1.44-fold, and the 31,500 clones on the cDNA array represent an estimated 21,875 different transcripts. 31,500 Clone Human cDNA Array: From the Human UniGene 1 clone set, cDNA inserts of the clones from the 82 first 384-well microtiter plates were amplified by PCR in a 384-well format (MJ Research, Boston, Massachusetts) using M13 forward (5'-CGTTGTAAAACGACGGCCAGT-3') and reverse primers (5'-TTTCACACAGGAAACAGCTATGAC-3'). The 31,488 PCR products were transferred in a 4x4 pattern onto a set of two 22x22 cm Hybond N+ nylon membranes (Amersham Pharmacia Biotech, Uppsala, Sweden) soaked in 0.4 M NaOH using a Picking-Spotting-Robot (Linear Drives LDT, Essex, UK) with 400 µm pins (Genetix, Hampshire, UK). After spotting the arrays were carefully floated for 2 minutes on 0.4 M NaOH and 5 x SSC (pH 7.5) successively, air dried and cross-linked by UV. Every 4x4 block contained one spot with PCR product from the bacterial kanamycin resistance gene to serve as a guide spot in automated image analysis, one empty spot to serve as background measurement and DNA from seven clones spotted in duplicate. On each filter, a control plate containing putative housekeeping genes and positive and negative controls was spotted. To assure even quality between subsequent rounds of hybridization, cDNA arrays were pre-stripped before their first use (Hauser et al., 1998). To check for filter quality, M13 forward oligonucleotide hybridizations were carried out. Keywords = membrane, filter |
| 5 |
GPL9 |
Human Unigene I, part 1 |
36,864 |
German Cancer Research Center |
2001-05-30 |
|
Homo sapiens
|
cDNA Array |
spotted DNA/cDNA, Human Unigene I, part 1, Human cDNA filter from the Resource Centre of the German Human Genome Project. Each of the two parts (GPL9 and GPL10) contains half of 31,488 PCR amplificates of human cDNAs selected as representatives of UniGene clusters (Build #17, NCBI) Selection of a Global Human Clone Set: In order to generate a non-redundant human clone set, we postprocessed the UniGene clusters (Build 17, NCBI), which represent a large number of human genes. All processing steps are part of the GeneNest software (Haas et al., 2000), that additionally provides an interactive graphical interface to the postprocessed UniGene database (http://www.dkfz.de/tbi/services/GeneNest/index). To identify the most reliable, representative clone from each cluster, we analyzed the following criteria (sorted according to their importance): (1) Availability of clones at the RZPD. (2) Quality of cDNA library of origin. (3) Presence of more than one read of the same clone in a cluster, ensuring a higher confidence in the sequence - clone relationship. (4) Calculated insert size, selecting for larger inserts. (5) Presence of a polyA signal. We used a fuzzy logic based rule system to combine all clone selection criteria in order to obtain a quality measure of each clone in the entire UniGene set. For each cluster we selected the clone with the highest quality as representative. To estimate the redundancy of the global clone set, we re-sequenced over 2,700 clones of the set and found 12.8% wrongly assigned clones. All of these belonged to clusters that were already represented by another clone. Therefore, the overall redundancy of the clone set was estimated to be 1.44-fold, and the 31,500 clones on the cDNA array represent an estimated 21,875 different transcripts. 31,500 Clone Human cDNA Array: From the Human UniGene 1 clone set, cDNA inserts of the clones from the 82 first 384-well microtiter plates were amplified by PCR in a 384-well format (MJ Research, Boston, Massachusetts) using M13 forward (5'-CGTTGTAAAACGACGGCCAGT-3') and reverse primers (5'-TTTCACACAGGAAACAGCTATGAC-3'). The 31,488 PCR products were transferred in a 4x4 pattern onto a set of two 22x22 cm Hybond N+ nylon membranes (Amersham Pharmacia Biotech, Uppsala, Sweden) soaked in 0.4 M NaOH using a Picking-Spotting-Robot (Linear Drives LDT, Essex, UK) with 400 µm pins (Genetix, Hampshire, UK). After spotting the arrays were carefully floated for 2 minutes on 0.4 M NaOH and 5 x SSC (pH 7.5) successively, air dried and cross-linked by UV. Every 4x4 block contained one spot with PCR product from the bacterial kanamycin resistance gene to serve as a guide spot in automated image analysis, one empty spot to serve as background measurement and DNA from seven clones spotted in duplicate. On each filter, a control plate containing putative housekeeping genes and positive and negative controls was spotted. To assure even quality between subsequent rounds of hybridization, cDNA arrays were pre-stripped before their first use (Hauser et al., 1998). To check for filter quality, M13 forward oligonucleotide hybridizations were carried out. Keywords = membrane, filter |
| 6 |
GPL28 |
HumArray 1.14 |
2,463 |
University of California San Francisco |
2002-01-10 |
|
Homo sapiens
|
cDNA Array |
spotted DNA/cDNA, HumArray 1.14, This array was designed for copy-number assessments across the human genome. We printed 2,460 BAC and P1 clones in triplicate (approx. 7,500 elements) in a 12mm X 12mm square. Each clone contains at least one STS, allowing linkage to the genome sequence. Cytogenetic mapping indicated that 2,298 of the arrayed clones are single copy; this array thus provides average resolution of approximately 1.4 Mb across the genome. Protocol from Nat Genet 2001 Nov;29(3):263-4 web supplement: <b>Genomic clones.</b> We selected the majority of the clones for the arrays from the set of cytogenetically mapped BACs reported previously4 and obtained these clones from the Roswell Park Cancer Institute. We obtained additional clones mapping near the telomeres of each chromosome5 and clones containing certain named genes from J. Flint, D. Ledbetter, C. Lese and Vysis, Inc. We included P1 clones used previously on arrays of chromosome 20 (ref. 1,2). We also used additional clones from the DuPont A library, including RMC01P052 (163D7), RMC01P057 (213C4), RMC07P014 (548H7), RMC07P025 (1128F4), RMC07P028 (252B4) and RMC07P038 (1429E1.c2), as well as RMC17P041 (75D7), RMC17P069 (88H6) and RMCXP002 (124A3) from the DuPont B library. The array provides only minimal coverage of the Y chromosome, since only one clone unique to the Y chromosome is included on the array in addition to the telomeric clones that are shared between the X and Y chromosomes. <b>Isolation of BAC/P1 DNA.</b> We inoculated 0.1l of a glycerol stock of BAC or P1 containing bacteria into 5 ml LB media containing chloramphenicol (10 g/ml) or kanamycin (50 g/ml) for BACs or P1s, respectively and incubated the cultures overnight (~16 h) at 37 C with agitation at 225 rpm. We prepared larger cultures for DNA isolation, by inoculating 25 mlLB media, containing the appropriate antibiotic with 200 l of the previously grown overnight culture and incubating in a shaking incubator at 37 C at 225 rpm overnight (~16 h). We monitored bacterial growth by measuring the OD of a 1:10 dilution, which preferably ranged between 0.25 and 0.35 at a wavelength of 600 nm. We used the Qiagen Plasmid Mini kit to isolate DNA, following a modified version of the Qiagen Plasmid Mini Purification protocol. We transferred the 25 ml cultures into 50 ml tubes and centrifuged them for 15 min at 4000 rcf at 4 C to pellet the bacteria. We re-suspended the pellet in Qiagen buffer P1 (1.5 ml), containing RNase A at the manufacturer's recommended concentration and then added buffer P2 (1.5 ml). We mixed the tubes extremely gently by inversion and incubated at room temperature for 5 min. Then, we added buffer P3 (1.5 ml), again mixed very gently by inversion and incubated on ice for 10 min. We inverted each tube once and centrifuged at 4000 rpm at 4 C until the supernatant became clear (45 to 60 min). We filtered the supernatant through a 35-micron nylon mesh prior to loading onto Qiagen-tip 20 columns, which had been equilibrated following the manufacturer's protocol. We followed the manufacturer's protocol for the DNA isolation steps with the exception that the elution buffer QF was heated to 65 C before it was added to the column. After elution, we added 0.56 ml isopropanol to the DNA and incubated overnight at 4 C. We collected the DNA pellet by centrifugation for 45 min at 14000 rpm at 4 C. After aspirating the supernatant, we allowed the pellet to dry in air for at most 30 min before re-suspending the DNA in 50 l of H2O. We determined the DNA concentration using a fluorometer. The yield typically ranged between 60-100 ng/l (i.e. 3-5 g per isolation). To ascertain DNA purity, we digested each BAC (200 ng) with HindIII and electrophoresed the digest through a 0.75% agarose gel. We discarded DNA preparations that showed a significant contamination with host bacterial DNA, seen as a background smear of degraded DNA in the gel. <b>Preparation of BAC/P1 DNA representations by ligation-mediated PCR.</b> We digested the DNA with MseI by incubating overnight at 37 C in a 5 l reaction containing 1.5 l DNA (20 to 600 ng), 0.4 U/l MseI (New England Biolabs), and 0.4x One-Phor-All-Buffer-Plus (Amersham). For ligation of adapters, we diluted 1 l of each digest to a final concentration of 1 ng/l with H2O and then mixed 1 ng of the digested DNA with 0.5 l One-Phor-All-Buffer-Plus (10x, Amersham), 0.5 l of 100 M Primer 1 (TAACTAGCATGC), 0.5 l of 100 M Primer 2 (5' aminolinker AGTGGGATTCCGCATGCTAGT) and 5.5 l H2O. We incubated the mixture at 65 C for 1 min after which we ramped the temperature down to 15 C with a ramp-speed of 1.3 C per minute. When the temperature reached 15 C, we added 1 l of 10 mM ATP and 1 l T4-DNA ligase (5 U/l, Gibco BRL) and continued incubation at 15 C overnight. To initiate the first round of PCR amplification, we added a 40 l mixture, consisting of 3 l PCR Buffer 1 (Expand Long Template PCR System, Roche), 2 l of a mixture of each nucleotide (10 mM) and 35 l H2O to the ligation reaction. Before we started the PCR program, we incubated the reaction at 68 C for 4 min and then added 1 l DNA polymerase (3.5 U/l, Expand Long Template PCR System, Roche). We carried out thermal cycling in a Perkin-Elmer Gene Amp PCR System 9700 block as follows: 94 C for 40 s, 57 C for 30 s, 68 C for 1.25 min for 14 cycles, followed by, 94 C for 40 s, 57 C for 30 s, 68 C for 1.75 min for 34 cycles and 94 C for 40 s, 57 C for 30 s and 68 C for 5 min for the final cycle. We electrophoresed 3.5 l of the PCR product through a 1% agarose gel to determine the size range of the amplified DNA, which ideally ranged from 100 to 2000 bp. To make the DNA for spotting on the arrays, we carried out a second round of amplification in a 100 l reaction containing 1 l of the primary PCR product, 4 M Primer 2, TAQ-buffer II (1x; Perkin Elmer), 0.2 mM dNTP mix, 5.5 mM MgCl2 (Perkin Elmer), 2.5 U Amplitaq Gold (Perkin Elmer) and H2O. We carried out an initial incubation at 95 C for 10 min in a MJ Research Peltier Thermal Cycler 225, followed by 95 C for 30 s, 50 C for 30 s and 72 C for 2 min for 45 cycles and finally 7 min at 72 C. This reaction yields ~10 g of DNA, with each fragment containing a 5' amino linker. <b>Preparation of DNA spotting solutions.</b> We evaporated the amplification reaction (100 l) to a final volume of 50 l by incubation at 45 C in a hybridization oven (Techne, Hybridizer HB-1D) for approximately 75 min and then added 2.5 volumes of ice-cold ethanol and 0.1 volumes of 3 M NaOAc to precipitate the DNA. (The use of ethanol precipitation proved superior to isopropanol precipitation.) We inverted the tubes and chilled them at 20 C for 15 min before collecting the precipitate by centrifugation at 1699 rcf for 90 min. We washed the pellets with 70% ethanol (150 l) and collected them by centrifugation at 1699 rcf for 45 min. We air-dried the pellets for approximately 60 to 90 min and then re-suspended them in 12 l of 20% DMSO in H2O (~0.8 g/l). We transferred the DNA solutions into 864 well microtitre plates for robotic arraying. Previously, we prepared DNA for spotting in 80% DMSO and 0.3 g/l nitrocellulose. However, we subsequently evaluated spotting solutions containing various concentrations of dimethyl formamide, formamide or DMSO, with or without nitrocellulose. We determined that nitrocellulose was not required for spotting DNA prepared by PCR using primers with 5'amino linkers and that spotting solutions made with 20% DMSO performed well. We have also generated representations of large insert clones for arraying by using degenerate oligonucleotide primed PCR and by amplification of mixtures of subclones from BACs, but found the ligation-mediated PCR procedure to be superior. <b>Array printing.</b> We used a custom built printer, employing a 4 x 4 array of quartz capillary tubes spaced on 3 mm centers to print ~70-100 µm diameter spots on 130 µm centers. We printed each DNA solution in triplicate to create an array of ~7500 elements in a 12 mm square area. We printed the arrays on chromium coated microscope slides (PTI or Nanofilm) for these studies, but also routinely print the arrays on glass slides (Corning GAPs). We allowed the printed slides to dry overnight, then exposed the slides to UV light (65 mJ) in a UV Stratalinker 2400 (Stratagene). We hybridized to these slides without additional treatment, except for the pre-hybridization slide blocking described below. We found no indication of DNA loss from the spots at any stage of the procedure when we performed hybridization in formamide buffers at 37 °C. Keywords = comparative genomic hybridization, CGH, array |
| 7 |
GPL44 |
FHCRC Human 18K Array |
17,588 |
Fred Hutchinson Cancer Research Center |
2002-02-04 |
|
Homo sapiens
|
cDNA Array |
spotted DNA/cDNA, FHCRC Human 18K Array, Microarray construction and hybridization protocols were modified from DeRisi, J.L., V.R Iyer, and P.O. Brown. Science 278:680-686, 1997. The microarrays were constructed using a set of more than 17000 sequence-verified clones from Research Genetics (UniGene Build 136). The cDNA inserts were amplified from replica plate cultures by PCR, purified and mechanically spotted onto polylysine-coated microscope slides using an OmniGrid robotic spotter (GeneMachines, San Carlo, CA). |
| 8 |
GPL97 |
[HG-U133B] Affymetrix Human Genome U133B Array |
22,645 |
Affymetrix, Inc. |
2002-02-19 |
Affymetrix |
Homo sapiens
|
GeneChip |
in situ oligonucleotide, [HG-U133B] Affymetrix Human Genome U133B Array, Affymetrix submissions are typically submitted to GEO using the GEOarchive method described at http://www.ncbi.nlm.nih.gov/projects/geo/info/geo_affy.html June 03, 2009: annotation table updated with netaffx build 28 June 21, 2012: annotation table updated with netaffx build 32 |
| 9 |
GPL96 |
[HG-U133A] Affymetrix Human Genome U133A Array |
22,283 |
Affymetrix, Inc. |
2002-02-19 |
Affymetrix |
Homo sapiens
|
GeneChip |
in situ oligonucleotide, [HG-U133A] Affymetrix Human Genome U133A Array, Affymetrix submissions are typically submitted to GEO using the GEOarchive method described at http://www.ncbi.nlm.nih.gov/geo/info/geo_affy.html The U133 set includes 2 arrays with a total of 44928 entries and was indexed 29-Jan-2002. The set includes over 1,000,000 unique oligonucleotide features covering more than 39,000 transcript variants, which in turn represent greater than 33,000 of the best characterized human genes. Sequences were selected from GenBank, dbEST, and RefSeq. Sequence clusters were created from Build 133 of UniGene (April 20, 2001) and refined by analysis and comparison with a number of other publicly available databases including the Washington University EST trace repository and the University of California, Santa Cruz golden-path human genome database (April 2001 release). In addition, ESTs were analyzed for untrimmed low-quality sequence information, correct orientation, false priming, false clustering, alternative splicing and alternative polyadenylation. Keywords = high density oligonucleotide array |
| 10 |
GPL93 |
[HG_U95C] Affymetrix Human Genome U95C Array |
12,646 |
Affymetrix, Inc. |
2002-02-19 |
Affymetrix |
Homo sapiens
|
GeneChip |
in situ oligonucleotide, [HG_U95C] Affymetrix Human Genome U95C Array, Affymetrix submissions are typically submitted to GEO using the GEOarchive method described at http://www.ncbi.nlm.nih.gov/projects/geo/info/geo_affy.html June 03, 2009: annotation table updated with netaffx build 28 June 21, 2012: annotation table updated with netaffx build 32 |
| 11 |
GPL94 |
[HG_U95D] Affymetrix Human Genome U95D Array |
12,644 |
Affymetrix, Inc. |
2002-02-19 |
Affymetrix |
Homo sapiens
|
GeneChip |
in situ oligonucleotide, [HG_U95D] Affymetrix Human Genome U95D Array, Affymetrix submissions are typically submitted to GEO using the GEOarchive method described at http://www.ncbi.nlm.nih.gov/projects/geo/info/geo_affy.html The Human Genome U95 (HG-U95) Set, consisting of five GeneChip arrays, contains almost 63,000 probe sets interrogating approximately 54,000 clusters derived from the UniGene database (Build 95). Based on this build and associated annotations, the HG-U95Av2 Array represents approximately 10,000 full-length genes, while arrays B through E represent approximately 50,000 EST clusters. Keywords = high density oligonucleotide array |
| 12 |
GPL95 |
[HG_U95E] Affymetrix Human Genome U95E Array |
12,639 |
Affymetrix, Inc. |
2002-02-19 |
Affymetrix |
Homo sapiens
|
GeneChip |
in situ oligonucleotide, [HG_U95E] Affymetrix Human Genome U95E Array, Affymetrix submissions are typically submitted to GEO using the GEOarchive method described at http://www.ncbi.nlm.nih.gov/projects/geo/info/geo_affy.html The Human Genome U95 (HG-U95) Set, consisting of five GeneChip arrays, contains almost 63,000 probe sets interrogating approximately 54,000 clusters derived from the UniGene database (Build 95). Based on this build and associated annotations, the HG-U95Av2 Array represents approximately 10,000 full-length genes, while arrays B through E represent approximately 50,000 EST clusters. Keywords = high density oligonucleotide array |
| 13 |
GPL91 |
[HG_U95A] Affymetrix Human Genome U95A Array |
12,626 |
Affymetrix, Inc. |
2002-02-19 |
Affymetrix |
Homo sapiens
|
GeneChip |
in situ oligonucleotide, [HG_U95A] Affymetrix Human Genome U95A Array, Affymetrix submissions are typically submitted to GEO using the GEOarchive method described at http://www.ncbi.nlm.nih.gov/projects/geo/info/geo_affy.html The Human Genome U95 (HG-U95) Set, consisting of five GeneChip arrays, contains almost 63,000 probe sets interrogating approximately 54,000 clusters derived from the UniGene database (Build 95). Keywords = high density oligonucleotide array |
| 14 |
GPL92 |
[HG_U95B] Affymetrix Human Genome U95B Array |
12,620 |
Affymetrix, Inc. |
2002-02-19 |
Affymetrix |
Homo sapiens
|
GeneChip |
in situ oligonucleotide, [HG_U95B] Affymetrix Human Genome U95B Array, Affymetrix submissions are typically submitted to GEO using the GEOarchive method described at http://www.ncbi.nlm.nih.gov/projects/geo/info/geo_affy.html June 03, 2009: annotation table updated with netaffx build 28 June 21, 2012: annotation table updated with netaffx build 32 |
| 15 |
GPL98 |
[Hu35KsubA] Affymetrix Human 35K SubA Array |
8,934 |
Affymetrix, Inc. |
2002-02-19 |
Affymetrix |
Homo sapiens
|
GeneChip |
in situ oligonucleotide, [Hu35KsubA] Affymetrix Human 35K SubA Array, Affymetrix submissions are typically submitted to GEO using the GEOarchive method described at http://www.ncbi.nlm.nih.gov/projects/geo/info/geo_affy.html Has 35714 entries and was indexed 29-Jan-2002. Keywords = high density oligonucleotide array |
| 16 |
GPL100 |
[Hu35KsubC] Affymetrix Human 35K SubC Array |
8,928 |
Affymetrix, Inc. |
2002-02-19 |
Affymetrix |
Homo sapiens
|
GeneChip |
in situ oligonucleotide, [Hu35KsubC] Affymetrix Human 35K SubC Array, Affymetrix submissions are typically submitted to GEO using the GEOarchive method described at http://www.ncbi.nlm.nih.gov/projects/geo/info/geo_affy.html Has 35714 entries and was indexed 29-Jan-2002. Keywords = high density oligonucleotide array |
| 17 |
GPL101 |
[Hu35KsubD] Affymetrix Human 35K SubD Array |
8,928 |
Affymetrix, Inc. |
2002-02-19 |
Affymetrix |
Homo sapiens
|
GeneChip |
in situ oligonucleotide, [Hu35KsubD] Affymetrix Human 35K SubD Array, Affymetrix submissions are typically submitted to GEO using the GEOarchive method described at http://www.ncbi.nlm.nih.gov/projects/geo/info/geo_affy.html Has 35714 entries and was indexed 29-Jan-2002. |
| 18 |
GPL99 |
[Hu35KsubB] Affymetrix Human 35K SubB Array |
8,924 |
Affymetrix, Inc. |
2002-02-19 |
Affymetrix |
Homo sapiens
|
GeneChip |
in situ oligonucleotide, [Hu35KsubB] Affymetrix Human 35K SubB Array, Affymetrix submissions are typically submitted to GEO using the GEOarchive method described at http://www.ncbi.nlm.nih.gov/projects/geo/info/geo_affy.html Has 35714 entries and was indexed 29-Jan-2002. Keywords = high density oligonucleotide array |
| 19 |
GPL80 |
[Hu6800] Affymetrix Human Full Length HuGeneFL Array |
7,129 |
Affymetrix, Inc. |
2002-02-19 |
Affymetrix |
Homo sapiens
|
GeneChip |
in situ oligonucleotide, [Hu6800] Affymetrix Human Full Length HuGeneFL Array, Affymetrix submissions are typically submitted to GEO using the GEOarchive method described at http://www.ncbi.nlm.nih.gov/projects/geo/info/geo_affy.html Has 7129 entries and was indexed 29-Jan-2002. Probes represent approximately 5,000 full-length human sequences. Keywords = high density oligonucleotide array |
| 20 |
GPL74 |
[HC_G110] Affymetrix Human Cancer Array |
2,059 |
Affymetrix, Inc. |
2002-02-19 |
Affymetrix |
Homo sapiens
|
GeneChip |
in situ oligonucleotide, [HC_G110] Affymetrix Human Cancer Array, Affymetrix submissions are typically submitted to GEO using the GEOarchive method described at http://www.ncbi.nlm.nih.gov/projects/geo/info/geo_affy.html Has 2059 entries and was indexed 29-Jan-2002. The Human Cancer G110 array enables focused and cost-effective expression studies in cancer biology. A panel of leading cancer researchers selected the specific set of 1,700 full-length human genes implicated in cancer that comprise this array. Accession numbers for sequences selected were selected from GenBank flat file release number 110.0. Keywords = high density oligonucleotide array |
|
|