Gene Expression Omnibus (GEO) Overview Version:2013-04-06Japanese page
An overview of the GEO entries broken down by the measurement platforms and the features of the measured samples.
RSS
Data Unit : [ DataSet / Sample / Platform ] Show explanation>> <<Hide explanation
DataSet : Series(GSE) x Platform(GPL). A set of related gene expression data.
Sample : Biological materials.
platform : Methods or instruments used for the gene expression profilings.
The numbers shown in the tabs are the numbers of the data (series, samples or platforms) belonging to the groups.
  Human
(2,851)
  Primates
(60)
  Rodents
(2,590)
  Mammals
(41)
  Vertebrates
(39)
  Invertebrates
(59)
  Plants
(464)
  Bacteria
(78)
  Viruses
(0)
  Phages
(0)
  Unclassified
(120)
  All
(6,302)
 
  SAGE NlaIII
(0)
  SAGE RsaI
(0)
  SAGE Sau3A
(0)
  MPSS
(0)
  GeneChip
(24)
  Tiling Array
(0)
  cDNA Array
(2)
  Oligo Array
(0)
  Bead Array
(0)
  Protein Array
(0)
  Antibody
(0)
  RT-PCR
(15)
  HT-Seq
(0)
  Other
(0)
  All
(41)
 
  brain
(0)
  blood
(0)
  connective
(0)
  reproductive
(0)
  muscular
(0)
  digestive
(6)
  liver
(0)
  lung
(24)
  urinary
(0)
  endo/exo-crine
(0)
  embryo
(0)
  adult aerial structure
(0)
  young aerial structure
(0)
  root
(0)
  meristem/growing tissue
(0)
  flower/sexual organ
(0)
  seed/fruit/grain
(0)
  pooled
(11)
  unclassified
(0)
  all
(41)
 
1   |   2   |   3      »      
Sample ID Title Number of Data Institute Submission date Platform Sample type Species Organ class Reasoning of the classification
Keywords used for the classification are shown with bold font.
1 GSM35208 Sub vs. Sub, 500ng 12,288 University of Minnesota 2004-11-12 [RT-PCR] PorkChip 2,600 cDNA array (GPL1624) RNA Sus scrofa
Sus scrofa domestica
pooled Porcine jejunal intestinal tissue was obtained from 5-9 week old Yorkshire pigs as described previously (Green et al., 2003). Jejunal segments containing a Peyer's patch were stripped of the underlying smooth muscle layer and stored in RNAlater (Ambion, Inc., Austin, TX) immediately or mounted in an Ussing flux chamber (Green et al., 2003). Treatments were added to the luminal side of the Ussing chamber in both the presence and absence of 50 µM cycloheximide and incubated for 3 hours. Stimulation conditions consisted of (1) log phase Salmonella choleraesuis vaccine strain SC-54 (Roof and Doitchinoff, 1995) at an initial bacterial concentration of 2.7 x 104 CFU/ml; (2) 1 µg/ml lipopolysaccharide and 50 ng/ml cholera toxin (CT+LPS); (3) 100 nM phorbol myristate acetate, 1 mM 8-bromo-cyclic AMP and 5 µg/ml concanavalin A (PBC); and (4) incubated with no stimulation (normal). After the 3 hour incubation, tissues were removed, the region of tissue containing the Peyer's patch was excised and was stored in RNAlater (Ambion, Inc., Austin, TX) at Ð20¡C. RNA was isolated from all Peyer's patches using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA) and examined for quality using the RNA 6000 Nano LabChip Kit on an Agilent 2100 bioanalyzer system (Agilent Technologies, Palo Alto, CA). RNA from all normal tissues were pooled in equal amounts and used to create the normal tissue library. RNA from all immune stimulated tissues (Salmonella infection, CT+LPS, and PBC, with and without cycloheximide) were pooled in equal amounts and used to create the immune stimulated tissue library. Libraries were created in the pCMV¥Sport 6 plasmid using the SuperScript Plasmid System with Gateway Technology (Invitrogen Corporation, Carlsbad, CA) with a modified Not I d(T) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGCCT17VN 3'). The subtracted library was created by combining the normal and immune stimulated libraries and by subtracting porcine fibroblast RNA. cRNA was created from each of the subtracted, normal, and immune stimulated libraries following the MAXIscript in vitro transcription kit protocol (Ambion Inc., Austin, TX). The above cRNA's (200 ng) or isolated total RNA (10 ug) were used as templates for the reverse transcription and amino allyl coupling reaction. Either the SuperScript Indirect cDNA Labeling System (Invitrogen Corporation, Carlsbad, CA) was used for the reverse transcription reaction and clean-up steps or a similar homemade procedure was performed. The microarray chips were incubated at 63¡C for 5 to 16 hours, washed, dried, and scanned using a ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified with QuantArray software version 3 (PerkinElmer, Boston, MA) using the adaptive method to calculate the mean spot intensity and mean background intensity. Keywords = jejunal Peyer's patch Keywords = pig Keywords = small intestine Lot batch =
2 GSM35207 Sub vs. Sub, 2ug 12,288 University of Minnesota 2004-11-12 [RT-PCR] PorkChip 2,600 cDNA array (GPL1624) RNA Sus scrofa
Sus scrofa domestica
pooled Porcine jejunal intestinal tissue was obtained from 5-9 week old Yorkshire pigs as described previously (Green et al., 2003). Jejunal segments containing a Peyer's patch were stripped of the underlying smooth muscle layer and stored in RNAlater (Ambion, Inc., Austin, TX) immediately or mounted in an Ussing flux chamber (Green et al., 2003). Treatments were added to the luminal side of the Ussing chamber in both the presence and absence of 50 µM cycloheximide and incubated for 3 hours. Stimulation conditions consisted of (1) log phase Salmonella choleraesuis vaccine strain SC-54 (Roof and Doitchinoff, 1995) at an initial bacterial concentration of 2.7 x 104 CFU/ml; (2) 1 µg/ml lipopolysaccharide and 50 ng/ml cholera toxin (CT+LPS); (3) 100 nM phorbol myristate acetate, 1 mM 8-bromo-cyclic AMP and 5 µg/ml concanavalin A (PBC); and (4) incubated with no stimulation (normal). After the 3 hour incubation, tissues were removed, the region of tissue containing the Peyer's patch was excised and was stored in RNAlater (Ambion, Inc., Austin, TX) at Ð20¡C. RNA was isolated from all Peyer's patches using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA) and examined for quality using the RNA 6000 Nano LabChip Kit on an Agilent 2100 bioanalyzer system (Agilent Technologies, Palo Alto, CA). RNA from all normal tissues were pooled in equal amounts and used to create the normal tissue library. RNA from all immune stimulated tissues (Salmonella infection, CT+LPS, and PBC, with and without cycloheximide) were pooled in equal amounts and used to create the immune stimulated tissue library. Libraries were created in the pCMV¥Sport 6 plasmid using the SuperScript Plasmid System with Gateway Technology (Invitrogen Corporation, Carlsbad, CA) with a modified Not I d(T) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGCCT17VN 3'). The subtracted library was created by combining the normal and immune stimulated libraries and by subtracting porcine fibroblast RNA. cRNA was created from each of the subtracted, normal, and immune stimulated libraries following the MAXIscript in vitro transcription kit protocol (Ambion Inc., Austin, TX). The above cRNA's (200 ng) or isolated total RNA (10 ug) were used as templates for the reverse transcription and amino allyl coupling reaction. Either the SuperScript Indirect cDNA Labeling System (Invitrogen Corporation, Carlsbad, CA) was used for the reverse transcription reaction and clean-up steps or a similar homemade procedure was performed. The microarray chips were incubated at 63¡C for 5 to 16 hours, washed, dried, and scanned using a ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified with QuantArray software version 3 (PerkinElmer, Boston, MA) using the adaptive method to calculate the mean spot intensity and mean background intensity. Keywords = jejunal Peyer's patch Keywords = pig Keywords = small intestine Lot batch =
3 GSM35209 Sub vs. Sub, 200 ng 12,288 University of Minnesota 2004-11-12 [RT-PCR] PorkChip 2,600 cDNA array (GPL1624) RNA Sus scrofa
Sus scrofa domestica
pooled Porcine jejunal intestinal tissue was obtained from 5-9 week old Yorkshire pigs as described previously (Green et al., 2003). Jejunal segments containing a Peyer's patch were stripped of the underlying smooth muscle layer and stored in RNAlater (Ambion, Inc., Austin, TX) immediately or mounted in an Ussing flux chamber (Green et al., 2003). Treatments were added to the luminal side of the Ussing chamber in both the presence and absence of 50 µM cycloheximide and incubated for 3 hours. Stimulation conditions consisted of (1) log phase Salmonella choleraesuis vaccine strain SC-54 (Roof and Doitchinoff, 1995) at an initial bacterial concentration of 2.7 x 104 CFU/ml; (2) 1 µg/ml lipopolysaccharide and 50 ng/ml cholera toxin (CT+LPS); (3) 100 nM phorbol myristate acetate, 1 mM 8-bromo-cyclic AMP and 5 µg/ml concanavalin A (PBC); and (4) incubated with no stimulation (normal). After the 3 hour incubation, tissues were removed, the region of tissue containing the Peyer's patch was excised and was stored in RNAlater (Ambion, Inc., Austin, TX) at Ð20¡C. RNA was isolated from all Peyer's patches using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA) and examined for quality using the RNA 6000 Nano LabChip Kit on an Agilent 2100 bioanalyzer system (Agilent Technologies, Palo Alto, CA). RNA from all normal tissues were pooled in equal amounts and used to create the normal tissue library. RNA from all immune stimulated tissues (Salmonella infection, CT+LPS, and PBC, with and without cycloheximide) were pooled in equal amounts and used to create the immune stimulated tissue library. Libraries were created in the pCMV¥Sport 6 plasmid using the SuperScript Plasmid System with Gateway Technology (Invitrogen Corporation, Carlsbad, CA) with a modified Not I d(T) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGCCT17VN 3'). The subtracted library was created by combining the normal and immune stimulated libraries and by subtracting porcine fibroblast RNA. cRNA was created from each of the subtracted, normal, and immune stimulated libraries following the MAXIscript in vitro transcription kit protocol (Ambion Inc., Austin, TX). The above cRNA's (200 ng) or isolated total RNA (10 ug) were used as templates for the reverse transcription and amino allyl coupling reaction. Either the SuperScript Indirect cDNA Labeling System (Invitrogen Corporation, Carlsbad, CA) was used for the reverse transcription reaction and clean-up steps or a similar homemade procedure was performed. The microarray chips were incubated at 63¡C for 5 to 16 hours, washed, dried, and scanned using a ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified with QuantArray software version 3 (PerkinElmer, Boston, MA) using the adaptive method to calculate the mean spot intensity and mean background intensity. Keywords = jejunal Peyer's patch Keywords = pig Keywords = small intestine Lot batch =
4 GSM35215 Normal vs. Subtracted 2 12,288 University of Minnesota 2004-11-12 [RT-PCR] PorkChip 2,600 cDNA array (GPL1624) RNA Sus scrofa
Sus scrofa domestica
pooled Porcine jejunal intestinal tissue was obtained from 5-9 week old Yorkshire pigs as described previously (Green et al., 2003). Jejunal segments containing a Peyer's patch were stripped of the underlying smooth muscle layer and stored in RNAlater (Ambion, Inc., Austin, TX) immediately or mounted in an Ussing flux chamber (Green et al., 2003). Treatments were added to the luminal side of the Ussing chamber in both the presence and absence of 50 µM cycloheximide and incubated for 3 hours. Stimulation conditions consisted of (1) log phase Salmonella choleraesuis vaccine strain SC-54 (Roof and Doitchinoff, 1995) at an initial bacterial concentration of 2.7 x 104 CFU/ml; (2) 1 µg/ml lipopolysaccharide and 50 ng/ml cholera toxin (CT+LPS); (3) 100 nM phorbol myristate acetate, 1 mM 8-bromo-cyclic AMP and 5 µg/ml concanavalin A (PBC); and (4) incubated with no stimulation (normal). After the 3 hour incubation, tissues were removed, the region of tissue containing the Peyer's patch was excised and was stored in RNAlater (Ambion, Inc., Austin, TX) at Ð20¡C. RNA was isolated from all Peyer's patches using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA) and examined for quality using the RNA 6000 Nano LabChip Kit on an Agilent 2100 bioanalyzer system (Agilent Technologies, Palo Alto, CA). RNA from all normal tissues were pooled in equal amounts and used to create the normal tissue library. RNA from all immune stimulated tissues (Salmonella infection, CT+LPS, and PBC, with and without cycloheximide) were pooled in equal amounts and used to create the immune stimulated tissue library. Libraries were created in the pCMV¥Sport 6 plasmid using the SuperScript Plasmid System with Gateway Technology (Invitrogen Corporation, Carlsbad, CA) with a modified Not I d(T) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGCCT17VN 3'). The subtracted library was created by combining the normal and immune stimulated libraries and by subtracting porcine fibroblast RNA. cRNA was created from each of the subtracted, normal, and immune stimulated libraries following the MAXIscript in vitro transcription kit protocol (Ambion Inc., Austin, TX). The above cRNA's (200 ng) or isolated total RNA (10 ug) were used as templates for the reverse transcription and amino allyl coupling reaction. Either the SuperScript Indirect cDNA Labeling System (Invitrogen Corporation, Carlsbad, CA) was used for the reverse transcription reaction and clean-up steps or a similar homemade procedure was performed. The microarray chips were incubated at 63¡C for 5 to 16 hours, washed, dried, and scanned using a ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified with QuantArray software version 3 (PerkinElmer, Boston, MA) using the adaptive method to calculate the mean spot intensity and mean background intensity. Sample_dye_swap: Normal (Cy5)/ Subtracted (Cy3) Keywords = jejunal Peyer's patch Keywords = pig Keywords = small intestine Lot batch =
5 GSM35210 Normal vs. Subtracted 12,288 University of Minnesota 2004-11-12 [RT-PCR] PorkChip 2,600 cDNA array (GPL1624) RNA Sus scrofa
Sus scrofa domestica
pooled Porcine jejunal intestinal tissue was obtained from 5-9 week old Yorkshire pigs as described previously (Green et al., 2003). Jejunal segments containing a Peyer's patch were stripped of the underlying smooth muscle layer and stored in RNAlater (Ambion, Inc., Austin, TX) immediately or mounted in an Ussing flux chamber (Green et al., 2003). Treatments were added to the luminal side of the Ussing chamber in both the presence and absence of 50 µM cycloheximide and incubated for 3 hours. Stimulation conditions consisted of (1) log phase Salmonella choleraesuis vaccine strain SC-54 (Roof and Doitchinoff, 1995) at an initial bacterial concentration of 2.7 x 104 CFU/ml; (2) 1 µg/ml lipopolysaccharide and 50 ng/ml cholera toxin (CT+LPS); (3) 100 nM phorbol myristate acetate, 1 mM 8-bromo-cyclic AMP and 5 µg/ml concanavalin A (PBC); and (4) incubated with no stimulation (normal). After the 3 hour incubation, tissues were removed, the region of tissue containing the Peyer's patch was excised and was stored in RNAlater (Ambion, Inc., Austin, TX) at Ð20¡C. RNA was isolated from all Peyer's patches using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA) and examined for quality using the RNA 6000 Nano LabChip Kit on an Agilent 2100 bioanalyzer system (Agilent Technologies, Palo Alto, CA). RNA from all normal tissues were pooled in equal amounts and used to create the normal tissue library. RNA from all immune stimulated tissues (Salmonella infection, CT+LPS, and PBC, with and without cycloheximide) were pooled in equal amounts and used to create the immune stimulated tissue library. Libraries were created in the pCMV¥Sport 6 plasmid using the SuperScript Plasmid System with Gateway Technology (Invitrogen Corporation, Carlsbad, CA) with a modified Not I d(T) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGCCT17VN 3'). The subtracted library was created by combining the normal and immune stimulated libraries and by subtracting porcine fibroblast RNA. cRNA was created from each of the subtracted, normal, and immune stimulated libraries following the MAXIscript in vitro transcription kit protocol (Ambion Inc., Austin, TX). The above cRNA's (200 ng) or isolated total RNA (10 ug) were used as templates for the reverse transcription and amino allyl coupling reaction. Either the SuperScript Indirect cDNA Labeling System (Invitrogen Corporation, Carlsbad, CA) was used for the reverse transcription reaction and clean-up steps or a similar homemade procedure was performed. The microarray chips were incubated at 63¡C for 5 to 16 hours, washed, dried, and scanned using a ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified with QuantArray software version 3 (PerkinElmer, Boston, MA) using the adaptive method to calculate the mean spot intensity and mean background intensity. Sample_dye_swap: Normal (Cy3)/subtracted (Cy5) Keywords = jejunal Peyer's patch Keywords = pig Keywords = small intestine Lot batch =
6 GSM34304 JPP vs. j-MLN 12,288 University of Minneosta 2004-11-02 [RT-PCR] PorkChip 2,600 cDNA array (GPL1624) RNA Sus scrofa
Sus scrofa domestica
intestine pool of jejunal MLN JPP Pig1
7 GSM34309 JPP 4 vs. j-MLN 12,288 University of Minneosta 2004-11-02 [RT-PCR] PorkChip 2,600 cDNA array (GPL1624) RNA Sus scrofa
Sus scrofa domestica
intestine pool of jejunal MLN JPP Pig4
8 GSM34318 JPP 4 dye-swap vs. j-MLN 12,288 University of Minneosta 2004-11-02 [RT-PCR] PorkChip 2,600 cDNA array (GPL1624) RNA Sus scrofa
Sus scrofa domestica
intestine JPP Pig4 pool of jejunal MLN
9 GSM34306 JPP 3 vs. j-MLN 12,288 University of Minneosta 2004-11-02 [RT-PCR] PorkChip 2,600 cDNA array (GPL1624) RNA Sus scrofa
Sus scrofa domestica
intestine pool of jejunal MLN JPP Pig3
10 GSM34305 JPP 2 vs. j-MLN 12,288 University of Minneosta 2004-11-02 [RT-PCR] PorkChip 2,600 cDNA array (GPL1624) RNA Sus scrofa
Sus scrofa domestica
intestine pool of jejunal MLN JPP Pig 2
11 GSM34312 JPP 2 dye-swap vs. j-MLN 12,288 University of Minneosta 2004-11-02 [RT-PCR] PorkChip 2,600 cDNA array (GPL1624) RNA Sus scrofa
Sus scrofa domestica
intestine JPP Pig2 pool of jejunal MLN
12 GSM35214 Immune Stim. vs. Subtracted 2 12,288 University of Minnesota 2004-11-12 [RT-PCR] PorkChip 2,600 cDNA array (GPL1624) RNA Sus scrofa
Sus scrofa domestica
pooled Porcine jejunal intestinal tissue was obtained from 5-9 week old Yorkshire pigs as described previously (Green et al., 2003). Jejunal segments containing a Peyer's patch were stripped of the underlying smooth muscle layer and stored in RNAlater (Ambion, Inc., Austin, TX) immediately or mounted in an Ussing flux chamber (Green et al., 2003). Treatments were added to the luminal side of the Ussing chamber in both the presence and absence of 50 µM cycloheximide and incubated for 3 hours. Stimulation conditions consisted of (1) log phase Salmonella choleraesuis vaccine strain SC-54 (Roof and Doitchinoff, 1995) at an initial bacterial concentration of 2.7 x 104 CFU/ml; (2) 1 µg/ml lipopolysaccharide and 50 ng/ml cholera toxin (CT+LPS); (3) 100 nM phorbol myristate acetate, 1 mM 8-bromo-cyclic AMP and 5 µg/ml concanavalin A (PBC); and (4) incubated with no stimulation (normal). After the 3 hour incubation, tissues were removed, the region of tissue containing the Peyer's patch was excised and was stored in RNAlater (Ambion, Inc., Austin, TX) at Ð20¡C. RNA was isolated from all Peyer's patches using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA) and examined for quality using the RNA 6000 Nano LabChip Kit on an Agilent 2100 bioanalyzer system (Agilent Technologies, Palo Alto, CA). RNA from all normal tissues were pooled in equal amounts and used to create the normal tissue library. RNA from all immune stimulated tissues (Salmonella infection, CT+LPS, and PBC, with and without cycloheximide) were pooled in equal amounts and used to create the immune stimulated tissue library. Libraries were created in the pCMV¥Sport 6 plasmid using the SuperScript Plasmid System with Gateway Technology (Invitrogen Corporation, Carlsbad, CA) with a modified Not I d(T) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGCCT17VN 3'). The subtracted library was created by combining the normal and immune stimulated libraries and by subtracting porcine fibroblast RNA. cRNA was created from each of the subtracted, normal, and immune stimulated libraries following the MAXIscript in vitro transcription kit protocol (Ambion Inc., Austin, TX). The above cRNA's (200 ng) or isolated total RNA (10 ug) were used as templates for the reverse transcription and amino allyl coupling reaction. Either the SuperScript Indirect cDNA Labeling System (Invitrogen Corporation, Carlsbad, CA) was used for the reverse transcription reaction and clean-up steps or a similar homemade procedure was performed. The microarray chips were incubated at 63¡C for 5 to 16 hours, washed, dried, and scanned using a ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified with QuantArray software version 3 (PerkinElmer, Boston, MA) using the adaptive method to calculate the mean spot intensity and mean background intensity. Sample_dye_swap: Immune Stim. (Cy5)/ Subtracted (Cy3) Keywords = jejunal Peyer's patch Keywords = pig Keywords = small intestine Lot batch =
13 GSM35211 Immune Stim. vs. Subtracted 12,288 University of Minnesota 2004-11-12 [RT-PCR] PorkChip 2,600 cDNA array (GPL1624) RNA Sus scrofa
Sus scrofa domestica
pooled Porcine jejunal intestinal tissue was obtained from 5-9 week old Yorkshire pigs as described previously (Green et al., 2003). Jejunal segments containing a Peyer's patch were stripped of the underlying smooth muscle layer and stored in RNAlater (Ambion, Inc., Austin, TX) immediately or mounted in an Ussing flux chamber (Green et al., 2003). Treatments were added to the luminal side of the Ussing chamber in both the presence and absence of 50 µM cycloheximide and incubated for 3 hours. Stimulation conditions consisted of (1) log phase Salmonella choleraesuis vaccine strain SC-54 (Roof and Doitchinoff, 1995) at an initial bacterial concentration of 2.7 x 104 CFU/ml; (2) 1 µg/ml lipopolysaccharide and 50 ng/ml cholera toxin (CT+LPS); (3) 100 nM phorbol myristate acetate, 1 mM 8-bromo-cyclic AMP and 5 µg/ml concanavalin A (PBC); and (4) incubated with no stimulation (normal). After the 3 hour incubation, tissues were removed, the region of tissue containing the Peyer's patch was excised and was stored in RNAlater (Ambion, Inc., Austin, TX) at Ð20¡C. RNA was isolated from all Peyer's patches using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA) and examined for quality using the RNA 6000 Nano LabChip Kit on an Agilent 2100 bioanalyzer system (Agilent Technologies, Palo Alto, CA). RNA from all normal tissues were pooled in equal amounts and used to create the normal tissue library. RNA from all immune stimulated tissues (Salmonella infection, CT+LPS, and PBC, with and without cycloheximide) were pooled in equal amounts and used to create the immune stimulated tissue library. Libraries were created in the pCMV¥Sport 6 plasmid using the SuperScript Plasmid System with Gateway Technology (Invitrogen Corporation, Carlsbad, CA) with a modified Not I d(T) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGCCT17VN 3'). The subtracted library was created by combining the normal and immune stimulated libraries and by subtracting porcine fibroblast RNA. cRNA was created from each of the subtracted, normal, and immune stimulated libraries following the MAXIscript in vitro transcription kit protocol (Ambion Inc., Austin, TX). The above cRNA's (200 ng) or isolated total RNA (10 ug) were used as templates for the reverse transcription and amino allyl coupling reaction. Either the SuperScript Indirect cDNA Labeling System (Invitrogen Corporation, Carlsbad, CA) was used for the reverse transcription reaction and clean-up steps or a similar homemade procedure was performed. The microarray chips were incubated at 63¡C for 5 to 16 hours, washed, dried, and scanned using a ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified with QuantArray software version 3 (PerkinElmer, Boston, MA) using the adaptive method to calculate the mean spot intensity and mean background intensity. Sample_dye_swap: Immune Stim. (Cy3)/ Subtracted (Cy5) Keywords = jejunal Peyer's patch Keywords = pig Keywords = small intestine Lot batch =
14 GSM35213 Immune Stim. vs. Normal2 12,288 University of Minnesota 2004-11-12 [RT-PCR] PorkChip 2,600 cDNA array (GPL1624) RNA Sus scrofa
Sus scrofa domestica
pooled Porcine jejunal intestinal tissue was obtained from 5-9 week old Yorkshire pigs as described previously (Green et al., 2003). Jejunal segments containing a Peyer's patch were stripped of the underlying smooth muscle layer and stored in RNAlater (Ambion, Inc., Austin, TX) immediately or mounted in an Ussing flux chamber (Green et al., 2003). Treatments were added to the luminal side of the Ussing chamber in both the presence and absence of 50 µM cycloheximide and incubated for 3 hours. Stimulation conditions consisted of (1) log phase Salmonella choleraesuis vaccine strain SC-54 (Roof and Doitchinoff, 1995) at an initial bacterial concentration of 2.7 x 104 CFU/ml; (2) 1 µg/ml lipopolysaccharide and 50 ng/ml cholera toxin (CT+LPS); (3) 100 nM phorbol myristate acetate, 1 mM 8-bromo-cyclic AMP and 5 µg/ml concanavalin A (PBC); and (4) incubated with no stimulation (normal). After the 3 hour incubation, tissues were removed, the region of tissue containing the Peyer's patch was excised and was stored in RNAlater (Ambion, Inc., Austin, TX) at Ð20¡C. RNA was isolated from all Peyer's patches using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA) and examined for quality using the RNA 6000 Nano LabChip Kit on an Agilent 2100 bioanalyzer system (Agilent Technologies, Palo Alto, CA). RNA from all normal tissues were pooled in equal amounts and used to create the normal tissue library. RNA from all immune stimulated tissues (Salmonella infection, CT+LPS, and PBC, with and without cycloheximide) were pooled in equal amounts and used to create the immune stimulated tissue library. Libraries were created in the pCMV¥Sport 6 plasmid using the SuperScript Plasmid System with Gateway Technology (Invitrogen Corporation, Carlsbad, CA) with a modified Not I d(T) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGCCT17VN 3'). The subtracted library was created by combining the normal and immune stimulated libraries and by subtracting porcine fibroblast RNA. cRNA was created from each of the subtracted, normal, and immune stimulated libraries following the MAXIscript in vitro transcription kit protocol (Ambion Inc., Austin, TX). The above cRNA's (200 ng) or isolated total RNA (10 ug) were used as templates for the reverse transcription and amino allyl coupling reaction. Either the SuperScript Indirect cDNA Labeling System (Invitrogen Corporation, Carlsbad, CA) was used for the reverse transcription reaction and clean-up steps or a similar homemade procedure was performed. The microarray chips were incubated at 63¡C for 5 to 16 hours, washed, dried, and scanned using a ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified with QuantArray software version 3 (PerkinElmer, Boston, MA) using the adaptive method to calculate the mean spot intensity and mean background intensity. Sample_dye_swap: Immune Stim. (Cy5)/ Normal (Cy3) Keywords = jejunal Peyer's patch Keywords = pig Keywords = small intestine Lot batch =
15 GSM35212 Immune Stim. vs. Normal 12,288 University of Minnesota 2004-11-12 [RT-PCR] PorkChip 2,600 cDNA array (GPL1624) RNA Sus scrofa
Sus scrofa domestica
pooled Porcine jejunal intestinal tissue was obtained from 5-9 week old Yorkshire pigs as described previously (Green et al., 2003). Jejunal segments containing a Peyer's patch were stripped of the underlying smooth muscle layer and stored in RNAlater (Ambion, Inc., Austin, TX) immediately or mounted in an Ussing flux chamber (Green et al., 2003). Treatments were added to the luminal side of the Ussing chamber in both the presence and absence of 50 µM cycloheximide and incubated for 3 hours. Stimulation conditions consisted of (1) log phase Salmonella choleraesuis vaccine strain SC-54 (Roof and Doitchinoff, 1995) at an initial bacterial concentration of 2.7 x 104 CFU/ml; (2) 1 µg/ml lipopolysaccharide and 50 ng/ml cholera toxin (CT+LPS); (3) 100 nM phorbol myristate acetate, 1 mM 8-bromo-cyclic AMP and 5 µg/ml concanavalin A (PBC); and (4) incubated with no stimulation (normal). After the 3 hour incubation, tissues were removed, the region of tissue containing the Peyer's patch was excised and was stored in RNAlater (Ambion, Inc., Austin, TX) at Ð20¡C. RNA was isolated from all Peyer's patches using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA) and examined for quality using the RNA 6000 Nano LabChip Kit on an Agilent 2100 bioanalyzer system (Agilent Technologies, Palo Alto, CA). RNA from all normal tissues were pooled in equal amounts and used to create the normal tissue library. RNA from all immune stimulated tissues (Salmonella infection, CT+LPS, and PBC, with and without cycloheximide) were pooled in equal amounts and used to create the immune stimulated tissue library. Libraries were created in the pCMV¥Sport 6 plasmid using the SuperScript Plasmid System with Gateway Technology (Invitrogen Corporation, Carlsbad, CA) with a modified Not I d(T) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGCCT17VN 3'). The subtracted library was created by combining the normal and immune stimulated libraries and by subtracting porcine fibroblast RNA. cRNA was created from each of the subtracted, normal, and immune stimulated libraries following the MAXIscript in vitro transcription kit protocol (Ambion Inc., Austin, TX). The above cRNA's (200 ng) or isolated total RNA (10 ug) were used as templates for the reverse transcription and amino allyl coupling reaction. Either the SuperScript Indirect cDNA Labeling System (Invitrogen Corporation, Carlsbad, CA) was used for the reverse transcription reaction and clean-up steps or a similar homemade procedure was performed. The microarray chips were incubated at 63¡C for 5 to 16 hours, washed, dried, and scanned using a ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified with QuantArray software version 3 (PerkinElmer, Boston, MA) using the adaptive method to calculate the mean spot intensity and mean background intensity. Sample_dye_swap: Immune Stim. (Cy3)/ Normal (Cy5) Keywords = jejunal Peyer's patch Keywords = pig Keywords = small intestine Lot batch =
16 GSM34727 Dog3 Right Lung (NonInjured) Base NonDependent 22,283 Johns Hopkins University 2004-11-05 [GeneChip] [HG-U133A] Affymetrix Human Genome U133A Array (GPL96) RNA Canis lupus familiaris
Canis lupus familiaris
lung dog lungs
17 GSM34726 Dog3 Right Lung (NonInjured) Base Dependent 22,283 Johns Hopkins University 2004-11-05 [GeneChip] [HG-U133A] Affymetrix Human Genome U133A Array (GPL96) RNA Canis lupus familiaris
Canis lupus familiaris
lung dog lungs
18 GSM34723 Dog3 Right Lung (NonInjured) Apex NonDependent 22,283 Johns Hopkins University 2004-11-05 [GeneChip] [HG-U133A] Affymetrix Human Genome U133A Array (GPL96) RNA Canis lupus familiaris
Canis lupus familiaris
lung dog lungs
19 GSM34722 Dog3 Right Lung (NonInjured) Apex Dependent 22,283 Johns Hopkins University 2004-11-05 [GeneChip] [HG-U133A] Affymetrix Human Genome U133A Array (GPL96) RNA Canis lupus familiaris
Canis lupus familiaris
lung dog lungs
20 GSM34729 Dog3 Left Lung (Injured) Base NonDependent 22,283 Johns Hopkins University 2004-11-05 [GeneChip] [HG-U133A] Affymetrix Human Genome U133A Array (GPL96) RNA Canis lupus familiaris
Canis lupus familiaris
lung dog lungs
1   |   2   |   3      »