Gene Expression Omnibus (GEO) Overview Version：2013-04-06Japanese page
An overview of the GEO entries broken down by the measurement platforms and the features of the measured samples.
RSS
[ Top ] > [ Germany ]
Data Unit : [ DataSet / Sample / Platform ] Show explanation>> <<Hide explanation
DataSet : Series(GSE) x Platform(GPL). A set of related gene expression data.
Sample : Biological materials.
platform : Methods or instruments used for the gene expression profilings.
The numbers shown in the tabs are the numbers of the data (series, samples or platforms) belonging to the groups.
  Human
(27,231)		   Primates
(191)		   Rodents
(7,993)		   Mammals
(1,491)		   Vertebrates
(704)		   Invertebrates
(853)		   Plants
(4,347)		   Bacteria
(2,475)		   Viruses
(10)		   Phages
(0)		   Unclassified
(91)		   All
(45,412)		  
  SAGE NlaIII
(0)		   SAGE RsaI
(0)		   SAGE Sau3A
(0)		   MPSS
(0)		   GeneChip
(0)		   Tiling Array
(0)		   cDNA Array
(0)		   Oligo Array
(0)		   Bead Array
(0)		   Protein Array
(0)		   Antibody
(0)		   RT-PCR
(0)		   HT-Seq
(10)		   Other
(0)		   All
(10)		  
  brain
(0)		   blood
(0)		   connective
(0)		   reproductive
(0)		   muscular
(0)		   digestive
(0)		   liver
(0)		   lung
(0)		   urinary
(0)		   endo/exo-crine
(0)		   embryo
(0)		   adult aerial structure
(0)		   young aerial structure
(0)		   root
(0)		   meristem/growing tissue
(0)		   flower/sexual organ
(0)		   seed/fruit/grain
(0)		   pooled
(1)		   unclassified
(9)		   all
(10)		  
Sample ID Title Number of Data Institute Submission date Platform Sample type Species Organ class Reasoning of the classification
Keywords used for the classification are shown with bold font.
1 GSM425419 Tobacco rattle virus (TRV) derived small RNAs 0 Technische Universität München 2009-07-08 [HT Sequencing] 454 GS FLX (Tobacco rattle virus) (GPL9368) SRA Tobacco rattle virus
Tobacco rattle virus		 unclassified source_name:Inflorescences from Arabidopsis thaliana infected with TRV title:Tobacco rattle virus (TRV) derived small RNAs description:Virus: TRV Genus: Tobravirus Genome type: (+)-ssRNA bipartite barcode: CGAC 5' ADAPTOR: GCCTCCCTCGCGCCATCAGATCGTAGCGACCTGATA accesion number for virus isolate used: (NC_003805, NC_003811) processed file: smallRNA hit name - number after the virus name indicates how many times sRNA sequence was recovered.
2 GSM425420 Turnip mosaic virus (TuMV) derived small RNAs 0 Technische Universität München 2009-07-08 [HT Sequencing] 454 GS FLX (Turnip mosaic virus) (GPL9369) SRA Turnip mosaic virus
Turnip mosaic virus		 unclassified source_name:Inflorescences from Arabidopsis thaliana infected with TuMV title:Turnip mosaic virus (TuMV) derived small RNAs description:Virus: TuMV Genus: Potyvirus Genome type: (+)-ssRNA monopartite barcode: ACGC 5' ADAPTOR: GCCTCCCTCGCGCCATCAGATCGTAGACGCCTGATA accesion number for virus isolate used: (AB194802) processed file: smallRNA hit name - number after the virus name indicates how many times sRNA sequence was recovered.
3 GSM425421 Cucumber mosai virus (CMV) derived small RNAs 0 Technische Universität München 2009-07-08 [HT Sequencing] 454 GS FLX (Cucumber mosaic virus) (GPL9370) SRA Cucumber mosaic virus
Cucumber mosaic virus		 unclassified source_name:Inflorescences from Arabidopsis thaliana infected with CMV title:Cucumber mosai virus (CMV) derived small RNAs description:Virus: CMV Genus: Cucumovirus Genome type: (+)-ssRNA tripartite barcode: CGTG 5' ADAPTOR: GCCTCCCTCGCGCCATCAGATCGTAGCGTGCTGATA accesion number for virus isolate used: (NC_002035, NC_002034, D10538) processed file: smallRNA hit name - number after the virus name indicates how many times sRNA sequence was recovered.
4 GSM425422 Cymbidium ringspot virus (CymRSV) derived small RNAs 0 Technische Universität München 2009-07-08 [HT Sequencing] 454 GS FLX (Cymbidium ringspot virus) (GPL9371) SRA Cymbidium ringspot virus
Cymbidium ringspot virus		 unclassified source_name:Leaves from Nicothiana benthamiana infected with CymRSV title:Cymbidium ringspot virus (CymRSV) derived small RNAs description:Virus: CymRSV Genus:Tombusvirus Genome type: (+)-ssRNA monopartite barcode: GCAC 5' ADAPTOR: GCCTCCCTCGCGCCATCAGATCGTAGGCACCTGATA accesion number for virus isolate used: (NC_003532) processed file: smallRNA hit name - number after the virus name indicates how many times sRNA sequence was recovered.
5 GSM425423 Potato virus X (PVX) derived small RNAs 0 Technische Universität München 2009-07-08 [HT Sequencing] 454 GS FLX (Potato virus X) (GPL9372) SRA Potato virus X
Potato virus X		 unclassified source_name:Leaves from Nicothiana benthamiana infected with PVX title:Potato virus X (PVX) derived small RNAs description:Virus: PVX Genus: Potexvirus Genome type: (+)-ssRNA monopartite barcode: GCTG 5' ADAPTOR: GCCTCCCTCGCGCCATCAGATCGTAGGCTGCTGATA accesion number for virus isolate used: (NC_001455) processed file: smallRNA hit name - number after the virus name indicates how many times sRNA sequence was recovered.
6 GSM425424 Pepper mild mottle virus (PMMoV) derived small RNAs 0 Technische Universität München 2009-07-08 [HT Sequencing] 454 GS FLX (Pepper mild mottle virus) (GPL9373) SRA Pepper mild mottle virus
Pepper mild mottle virus		 unclassified source_name:Leaves from Nicothiana benthamiana infected with PMMoV title:Pepper mild mottle virus (PMMoV) derived small RNAs description:Virus: PMMoV Genus: Tobamovirus Genome type: (+)-ssRNA monopartite barcode: GCCA 5' ADAPTOR: GCCTCCCTCGCGCCATCAGATCGTAGGCCACTGATA accesion number for virus isolate used: (NC_003630) processed file: smallRNA hit name - number after the virus name indicates how many times sRNA sequence was recovered.
7 GSM425425 Melon necrotic spot virus (MNSV) derived small RNAs 0 Technische Universität München 2009-07-08 [HT Sequencing] 454 GS FLX (Melon necrotic spot virus) (GPL9374) SRA Melon necrotic spot virus
Melon necrotic spot virus		 unclassified source_name:Cotyledons from Cucumis melo infected with MNSV title:Melon necrotic spot virus (MNSV) derived small RNAs description:Virus: MNSV Genus: Carmovirus Genome type: (+)-ssRNA monopartite barcode: ACGC 5' ADAPTOR: GCCTCCCTCGCGCCATCAGATCGTAGACGCCTGATA accesion number for virus isolate used: (AY122286) processed file: smallRNA hit name - number after the virus name indicates how many times sRNA sequence was recovered.
8 GSM425426 Watermelon mosaic virus (WMV) derived small RNAs 0 Technische Universität München 2009-07-08 [HT Sequencing] 454 GS FLX (Watermelon mosaic virus) (GPL9375) SRA Watermelon mosaic virus
Watermelon mosaic virus		 unclassified source_name:Cotyledons from Cucumis melo infected with WMV title:Watermelon mosaic virus (WMV) derived small RNAs description:Virus: WMV Genus: Potyvirus Genome type: (+)-ssRNA monopartite barcode: GCCA / GCGT 5' ADAPTOR: GCCTCCCTCGCGCCATCAGATCGTAGGCCACTGATA / GCCTCCCTCGCGCCATCAGATCGTAGGCGTCTGATA accesion number for virus isolate used: (AY437609) processed file: smallRNA hit name - number after the virus name indicates how many times sRNA sequence was recovered.
9 GSM425427 Tomato yellow leaf curl virus (TYLCV) derived small RNAs 0 Technische Universität München 2009-07-08 [HT Sequencing] 454 GS FLX (Tomato yellow leaf curl virus) (GPL9376) SRA Tomato yellow leaf curl virus
Tomato yellow leaf curl virus		 pooled Tomato yellow leaf curl virus (TYLCV) derived small RNAs
10 GSM425428 Melon necrotic spot virus (MNSV) chimeric virus derived small RNAs 0 Technische Universität München 2009-07-08 [HT Sequencing] 454 GS FLX (Melon necrotic spot virus) (GPL9374) SRA Melon necrotic spot virus
Melon necrotic spot virus		 unclassified source_name:Cotyledons from Cucumis melo infected with MNSV chimeric virus title:Melon necrotic spot virus (MNSV) chimeric virus derived small RNAs description:Virus: MNSV Genus: Carmovirus Genome type: (+)-ssRNA monopartite barcode: ACCG / AGGC 5' ADAPTOR: GCCTCCCTCGCGCCATCAGATCGTAGACCGCTGATA / GCCTCCCTCGCGCCATCAGATCGTAGAGGCCTGATA processed file: smallRNA hit name - number after the virus name indicates how many times sRNA sequence was recovered.
DBCLS | Site Policies | Contact Us