Gene Expression Omnibus (GEO) Overview Version：2013-04-06Japanese page
An overview of the GEO entries broken down by the measurement platforms and the features of the measured samples.
RSS
Data Unit : [ DataSet / Sample / Platform ] Show explanation>> <<Hide explanation
DataSet : Series(GSE) x Platform(GPL). A set of related gene expression data.
Sample : Biological materials.
platform : Methods or instruments used for the gene expression profilings.
The numbers shown in the tabs are the numbers of the data (series, samples or platforms) belonging to the groups.
  Human
(502,421)		   Primates
(4,928)		   Rodents
(181,106)		   Mammals
(16,260)		   Vertebrates
(18,263)		   Invertebrates
(37,338)		   Plants
(91,454)		   Bacteria
(39,082)		   Viruses
(1,266)		   Phages
(101)		   Unclassified
(5,242)		   All
(898,944)		  
  SAGE NlaIII
(0)		   SAGE RsaI
(0)		   SAGE Sau3A
(0)		   MPSS
(0)		   GeneChip
(0)		   Tiling Array
(40)		   cDNA Array
(102)		   Oligo Array
(1,057)		   Bead Array
(0)		   Protein Array
(0)		   Antibody
(0)		   RT-PCR
(0)		   HT-Seq
(67)		   Other
(0)		   All
(1,266)		  
  brain
(12)		   blood
(274)		   connective
(420)		   reproductive
(0)		   muscular
(0)		   digestive
(1)		   liver
(0)		   lung
(28)		   urinary
(0)		   endo/exo-crine
(0)		   embryo
(0)		   adult aerial structure
(0)		   young aerial structure
(0)		   root
(0)		   meristem/growing tissue
(0)		   flower/sexual organ
(0)		   seed/fruit/grain
(0)		   pooled
(1)		   unclassified
(530)		   all
(1,266)		  
1   |   2   |   3   |   4   |   5      »      [27]
Sample ID Title Number of Data Institute Submission date Platform Sample type Species Organ class Reasoning of the classification
Keywords used for the classification are shown with bold font.
1 GSM534900 Zaire ebolavirus-241 14,864 Washington University in St. Louis, School of Medicine 2010-04-20 [cDNA Array] Hemorrhagic Fever Microarray Release I (V2.10HF) (GPL10345) RNA Zaire ebolavirus
Zaire ebolavirus		 unclassified source_name:infected culture title:Zaire ebolavirus-241 description:hybridization of infected culture for use in testing the performance of VIPR
2 GSM534898 Zaire ebolavirus-239 14,864 Washington University in St. Louis, School of Medicine 2010-04-20 [cDNA Array] Hemorrhagic Fever Microarray Release I (V2.10HF) (GPL10345) RNA Zaire ebolavirus
Zaire ebolavirus		 unclassified source_name:infected culture title:Zaire ebolavirus-239 description:hybridization of infected culture for use in testing the performance of VIPR
3 GSM534876 Zaire ebolavirus-215 14,864 Washington University in St. Louis, School of Medicine 2010-04-20 [cDNA Array] Hemorrhagic Fever Microarray Release I (V2.10HF) (GPL10345) RNA Zaire ebolavirus
Zaire ebolavirus		 unclassified source_name:infected culture title:Zaire ebolavirus-215 description:hybridization of infected culture for use in testing the performance of VIPR
4 GSM532794 Zaire ebolavirus (ZEBOV) 45,220 Columbia University 2010-04-12 [Oligo Array] Virus 45K Microarray - Agilent 2517771 (GPL10320) RNA Zaire ebolavirus
Zaire ebolavirus		 unclassified source_name:ZEBOV RNA from infected tissue culture cells title:Zaire ebolavirus (ZEBOV) description:Table 3, Table 4 Zaire ebolavirus
5 GSM1006711 yw-IIV6 0 CNRS 2012-09-19 [HT Sequencing] Illumina HiSeq 2000 (Invertebrate iridescent virus 6) (GPL16081) SRA Invertebrate iridescent virus 6
Invertebrate iridescent virus 6		 unclassified source_name:Adult flies title:yw-IIV6 description:IIV6 infected Drosophila adult flies
6 GSM534915 Yellow fever virus-266 14,864 Washington University in St. Louis, School of Medicine 2010-04-20 [cDNA Array] Hemorrhagic Fever Microarray Release I (V2.10HF) (GPL10345) RNA Yellow fever virus
Yellow fever virus		 unclassified source_name:infected culture title:Yellow fever virus-266 description:hybridization of infected culture for use in testing the performance of VIPR
7 GSM534909 Yellow fever virus-256 14,864 Washington University in St. Louis, School of Medicine 2010-04-20 [cDNA Array] Hemorrhagic Fever Microarray Release I (V2.10HF) (GPL10345) RNA Yellow fever virus
Yellow fever virus		 unclassified source_name:infected culture title:Yellow fever virus-256 description:hybridization of infected culture for use in testing the performance of VIPR
8 GSM534894 Yellow fever virus-235 14,864 Washington University in St. Louis, School of Medicine 2010-04-20 [cDNA Array] Hemorrhagic Fever Microarray Release I (V2.10HF) (GPL10345) RNA Yellow fever virus
Yellow fever virus		 unclassified source_name:infected culture title:Yellow fever virus-235 description:hybridization of infected culture for use in testing the performance of VIPR
9 GSM534872 Yellow fever virus-211 14,864 Washington University in St. Louis, School of Medicine 2010-04-20 [cDNA Array] Hemorrhagic Fever Microarray Release I (V2.10HF) (GPL10345) RNA Yellow fever virus
Yellow fever virus		 unclassified source_name:infected culture title:Yellow fever virus-211 description:hybridization of infected culture for use in testing the performance of VIPR
10 GSM532793 West Nile virus NY99 (WNV) 45,220 Columbia University 2010-04-12 [Oligo Array] Virus 45K Microarray - Agilent 2517771 (GPL10320) RNA West Nile virus
West Nile virus		 unclassified source_name:WNV RNA from infected tissue culture cells title:West Nile virus NY99 (WNV) description:Table 3, Table 4 West Nile Virus New York 1999
11 GSM425426 Watermelon mosaic virus (WMV) derived small RNAs 0 Technische Universität München 2009-07-08 [HT Sequencing] 454 GS FLX (Watermelon mosaic virus) (GPL9375) SRA Watermelon mosaic virus
Watermelon mosaic virus		 unclassified source_name:Cotyledons from Cucumis melo infected with WMV title:Watermelon mosaic virus (WMV) derived small RNAs description:Virus: WMV Genus: Potyvirus Genome type: (+)-ssRNA monopartite barcode: GCCA / GCGT 5' ADAPTOR: GCCTCCCTCGCGCCATCAGATCGTAGGCCACTGATA / GCCTCCCTCGCGCCATCAGATCGTAGGCGTCTGATA accesion number for virus isolate used: (AY437609) processed file: smallRNA hit name - number after the virus name indicates how many times sRNA sequence was recovered.
12 GSM8529 Water negative control 12,032 University of California, San Francisco 2003-07-21 [Oligo Array] MegaViroP1 (GPL366) RNA Viruses
Viruses		 unclassified source_name:water negative control title:Water negative control description:No template, water only, control Keywords = SARS Keywords = coronavirus Keywords = viral discovery Keywords = viruses Keywords = respiratory infection
13 GSM95960 Viro3P10-064 21,888 University of California, San Francisco 2006-02-07 [Oligo Array] Viro3 (GPL3429) RNA Viruses
Viruses		 unclassified source_name:amplified RNA from an ET aspirate sample from a patient with fulminant pneumonia title:Viro3P10-064 description:amplified RNA from an ET aspirate sample from a patient with fulminant pneumonia
14 GSM608706 Viral_mix_3 64,533 Lawrence Livermore National Laboratory 2010-10-14 [Oligo Array] Lawrence Livermore Microbial Detection Array version 1 (GPL11053) other Vaccinia virus Lister,Human herpesvirus 6B
Vaccinia virus Lister,Human herpesvirus 6B		 unclassified source_name:Human herpesvirus 6B; vaccinia virus strain Lister title:Viral_mix_3 description:Mixture of purified commercially purchased viral DNA from vaccinia virus strain Lister and human herpesvirus 6B Cy3 9mer
15 GSM532792 Vesicular stomatitis virus Indiana (VSV) 45,220 Columbia University 2010-04-12 [Oligo Array] Virus 45K Microarray - Agilent 2517771 (GPL10320) RNA Vesicular stomatitis Indiana virus
Vesicular stomatitis Indiana virus		 unclassified source_name:VSV RNA from infected tissue culture cells title:Vesicular stomatitis virus Indiana (VSV) description:Table 3, Table 4 Vesicular stomatitis virus strain Indiana
16 GSM217177 VA1.9 5,824 The Roslin Institute 2007-08-10 [Oligo Array] IAH/VLA Virus Detection Array VA1 (GPL5725) RNA Foot-and-mouth disease virus - type O
Foot-and-mouth disease virus - type O		 unclassified source_name:Amplified RNA from sheep infected with FMDV type O title:VA1.9 description:IAH/VLA sample VA1.9
17 GSM217175 VA1.7 5,824 The Roslin Institute 2007-08-10 [Oligo Array] IAH/VLA Virus Detection Array VA1 (GPL5725) RNA Foot-and-mouth disease virus - type A
Foot-and-mouth disease virus - type A		 unclassified source_name:Amplified RNA from cell cultured FMDV type A title:VA1.7 description:IAH/VLA sample VA1.7
18 GSM217172 VA1.6 5,824 The Roslin Institute 2007-08-10 [Oligo Array] IAH/VLA Virus Detection Array VA1 (GPL5725) RNA Foot-and-mouth disease virus - type A
Foot-and-mouth disease virus - type A		 unclassified source_name:Amplified RNA from cell cultured FMDV type A title:VA1.6 description:IAH/VLA sample VA1.6
19 GSM217169 VA1.5 5,824 The Roslin Institute 2007-08-10 [Oligo Array] IAH/VLA Virus Detection Array VA1 (GPL5725) RNA Foot-and-mouth disease virus - type O
Foot-and-mouth disease virus - type O		 unclassified source_name:Amplified RNA from cell cultured FMDV type O title:VA1.5 description:IAH/VLA sample VA1.5
20 GSM217167 VA1.4 5,824 The Roslin Institute 2007-08-10 [Oligo Array] IAH/VLA Virus Detection Array VA1 (GPL5725) RNA Foot-and-mouth disease virus - type O
Foot-and-mouth disease virus - type O		 unclassified source_name:Amplified RNA from cell cultured FMDV type O title:VA1.4 description:IAH/VLA sample VA1.4
1   |   2   |   3   |   4   |   5      »      [27]
DBCLS | Site Policies | Contact Us