Gene Expression Omnibus (GEO) Overview Version：2013-04-06Japanese page
An overview of the GEO entries broken down by the measurement platforms and the features of the measured samples.
RSS
Data Unit : [ DataSet / Sample / Platform ] Show explanation>> <<Hide explanation
DataSet : Series(GSE) x Platform(GPL). A set of related gene expression data.
Sample : Biological materials.
platform : Methods or instruments used for the gene expression profilings.
The numbers shown in the tabs are the numbers of the data (series, samples or platforms) belonging to the groups.
  Human
(502,421)		   Primates
(4,928)		   Rodents
(181,106)		   Mammals
(16,260)		   Vertebrates
(18,263)		   Invertebrates
(37,338)		   Plants
(91,454)		   Bacteria
(39,082)		   Viruses
(1,266)		   Phages
(101)		   Unclassified
(5,242)		   All
(898,944)		  
  SAGE NlaIII
(1,683)		   SAGE RsaI
(3)		   SAGE Sau3A
(54)		   MPSS
(439)		   GeneChip
(377,145)		   Tiling Array
(21,846)		   cDNA Array
(103,476)		   Oligo Array
(239,584)		   Bead Array
(106,999)		   Protein Array
(5)		   Antibody
(1,152)		   RT-PCR
(3,959)		   HT-Seq
(35,574)		   Other
(6,909)		   All
(898,944)		  
  brain
(2,393)		   blood
(4,818)		   connective
(1,764)		   reproductive
(1,760)		   muscular
(844)		   digestive
(1,192)		   liver
(1,008)		   lung
(949)		   urinary
(585)		   endo/exo-crine
(1,449)		   embryo
(2,545)		   adult aerial structure
(737)		   young aerial structure
(436)		   root
(188)		   meristem/growing tissue
(137)		   flower/sexual organ
(407)		   seed/fruit/grain
(153)		   pooled
(1,694)		   unclassified
(12,515)		   all
(35,574)		  
1   |   2   |   3   |   4   |   5      »      [626]
Sample ID Title Number of Data Institute Submission date Platform Sample type Species Organ class Reasoning of the classification
Keywords used for the classification are shown with bold font.
1 GSM433621 Small RNAs from maize ears 2,603,191 University of Delaware 2009-07-27 [HT Sequencing] Illumina Genome Analyzer II (Zea mays) (GPL9361) SRA Zea mays
Zea mays		 unclassified source_name:Female inflorescence (ears) title:Small RNAs from maize ears description:Total RNA was submitted to Illumina (Hayward, CA, http://www.illumina.com) for small RNA library construction using approaches described in (Lu et al., 2007) with minor modifications. Low molecular weight RNA was gel-sized in the ~18-33 nt range. The small RNA library was sequenced with the Sequencing-by-synthesis (SBS) technology by Illumina. Small RNAs from maize ears
2 GSM661298 s5_ago104 Ovaries 404,542 IRD 2011-01-25 [HT Sequencing] Illumina Genome Analyzer (Zea mays) (GPL9141) SRA Zea mays
Zea mays		 unclassified source_name:ago104_KO title:s5_ago104 Ovaries
3 GSM661297 s3_WildType Ovaries 386,281 IRD 2011-01-25 [HT Sequencing] Illumina Genome Analyzer (Zea mays) (GPL9141) SRA Zea mays
Zea mays		 unclassified source_name:wild-type title:s3_WildType Ovaries
4 GSM324087 Col-0 (TMV-Cg, 3dpi) 13,312 texas tech university 2008-09-24 [HT Sequencing] Illumina Genome Analyzer II (Youcai mosaic virus) (GPL9403) SRA Youcai mosaic virus
Youcai mosaic virus		 unclassified source_name:TMV-Cg infected Arabidopsis thaliana Col-0 host. title:Col-0 (TMV-Cg, 3dpi) description:The processed data below represent the sequence and normalized abundance of virus-derived small RNAs For the ease of retrieving the small RNA data, we organized the processed small RNAs captured from TMV-Cg-infected Col-0 tissues into multiple files, each containing a distinct size class ranging from 18- to 25-nt. _18nt.txt file is small RNAs of 18-nt in size _19nt.txt file is small RNAs of 19-nt in size _20nt.txt file is small RNAs of 20-nt in size _21nt.txt file is small RNAs of 21-nt in size _22nt.txt file is small RNAs of 22-nt in size _23nt.txt file is small RNAs of 23-nt in size _24nt.txt file is small RNAs of 24-nt in size _25nt.txt file is small RNAs of 25-nt in size Host genetic background: Wild type; Viral pathogen: TMV-Cg
5 GSM324089 rdr6-15 (TMV-Cg, 3dpi) 10,988 texas tech university 2008-09-24 [HT Sequencing] Illumina Genome Analyzer II (Youcai mosaic virus) (GPL9403) SRA Youcai mosaic virus
Youcai mosaic virus		 unclassified source_name:TMV-Cg infected Arabidopsis thaliana rdr6-15 host. title:rdr6-15 (TMV-Cg, 3dpi) description:The processed data below represent the sequence and normalized abundance of virus-derived small RNAs For the ease of retrieving the small RNA data, we organized the processed small RNAs captured from TMV-Cg-infected rdr6-15 tissues into multiple files, each containing a distinct size class ranging from 18- to 25-nt. _18nt.txt file is small RNAs of 18-nt in size _19nt.txt file is small RNAs of 19-nt in size _20nt.txt file is small RNAs of 20-nt in size _21nt.txt file is small RNAs of 21-nt in size _22nt.txt file is small RNAs of 22-nt in size _23nt.txt file is small RNAs of 23-nt in size _24nt.txt file is small RNAs of 24-nt in size _25nt.txt file is small RNAs of 25-nt in size Host genetic background: rdr6-15; Viral pathogen: TMV-Cg
6 GSM324088 rdr1-1 (TMV-Cg, 3dpi) 5,545 texas tech university 2008-09-24 [HT Sequencing] Illumina Genome Analyzer II (Youcai mosaic virus) (GPL9403) SRA Youcai mosaic virus
Youcai mosaic virus		 unclassified source_name:TMV-Cg infected Arabidopsis thaliana rdr1-1 host. title:rdr1-1 (TMV-Cg, 3dpi) description:The processed data below represent the sequence and normalized abundance of virus-derived small RNAs For the ease of retrieving the small RNA data, we organized the processed small RNAs captured from TMV-Cg-infected rdr1-1 tissues into multiple files, each containing a distinct size class ranging from 18- to 25-nt. _18nt.txt file is small RNAs of 18-nt in size _19nt.txt file is small RNAs of 19-nt in size _20nt.txt file is small RNAs of 20-nt in size _21nt.txt file is small RNAs of 21-nt in size _22nt.txt file is small RNAs of 22-nt in size _23nt.txt file is small RNAs of 23-nt in size _24nt.txt file is small RNAs of 24-nt in size _25nt.txt file is small RNAs of 25-nt in size Host genetic background: rdr1-1; Viral pathogen: TMV-Cg
7 GSM324086 Col-0 (Mock) 0 texas tech university 2008-09-24 [HT Sequencing] Illumina Genome Analyzer II (Youcai mosaic virus) (GPL9403) SRA Youcai mosaic virus
Youcai mosaic virus		 unclassified source_name:Mock-infected Arabidopsis thaliana Col-0 host. title:Col-0 (Mock) description:Small RNAs captured from mock-infected host tissues. The processed data below represent the sequence and normalized abundance of virus-derived small RNAs. Since this sample was a "mock-infected" negative control, no virus-derived small RNAs would be expected. Therefore, there was no processed data file associated with this particular sample. Host genetic background: Wil type; Viral pathogen: None
8 GSM552919 Yarrowia lipolytica genome-wide nucleosome data 0 MIT 2010-06-08 [HT Sequencing] Illumina Genome Analyzer (Yarrowia lipolytica) (GPL10512) SRA Yarrowia lipolytica
Yarrowia lipolytica		 unclassified source_name:in vivo cells title:Yarrowia lipolytica genome-wide nucleosome data description:Mnase digested DNA and size selected for mononucleosomes (~150bp)
9 GSM746611 X. tropicalis_stage 10.5 Smad2/3 0 Stanford University 2011-06-22 [HT Sequencing] Illumina Genome Analyzer II (Xenopus (Silurana) tropicalis) (GPL9320) SRA Xenopus (Silurana) tropicalis
Xenopus tropicalis		 unclassified source_name:Chromatin IP against Smad2/3 title:X. tropicalis_stage 10.5 Smad2/3 description:Chromatin IP against Smad2/3
10 GSM746612 X. tropicalis_stage 10.5 Input 0 Stanford University 2011-06-22 [HT Sequencing] Illumina Genome Analyzer II (Xenopus (Silurana) tropicalis) (GPL9320) SRA Xenopus (Silurana) tropicalis
Xenopus tropicalis		 unclassified source_name:Input DNA title:X. tropicalis_stage 10.5 Input description:Input DNA
11 GSM425426 Watermelon mosaic virus (WMV) derived small RNAs 0 Technische Universität München 2009-07-08 [HT Sequencing] 454 GS FLX (Watermelon mosaic virus) (GPL9375) SRA Watermelon mosaic virus
Watermelon mosaic virus		 unclassified source_name:Cotyledons from Cucumis melo infected with WMV title:Watermelon mosaic virus (WMV) derived small RNAs description:Virus: WMV Genus: Potyvirus Genome type: (+)-ssRNA monopartite barcode: GCCA / GCGT 5' ADAPTOR: GCCTCCCTCGCGCCATCAGATCGTAGGCCACTGATA / GCCTCCCTCGCGCCATCAGATCGTAGGCGTCTGATA accesion number for virus isolate used: (AY437609) processed file: smallRNA hit name - number after the virus name indicates how many times sRNA sequence was recovered.
12 GSM803797 Small RNAs from Volvox carteri control 1,143,556 University of Delaware 2011-09-29 [HT Sequencing] Illumina Genome Analyzer II (Volvox carteri) (GPL9922) SRA Volvox carteri
Volvox carteri		 unclassified source_name:Control title:Small RNAs from Volvox carteri control description:VCA1 Total RNA was submitted to Illumina (Hayward, CA, http://www.illumina.com) for small RNA library construction using approaches described in (Lu et al., 2007) with minor modifications. Low molecular weight RNA was gel-sized in the ~18-33 nt range. The small RNA library was sequenced with the Sequencing-by-synthesis (SBS) technology by Illumina.
13 GSM803798 Small RNAs from Volvox carteri under sulphate starvation 1,140,682 University of Delaware 2011-09-29 [HT Sequencing] Illumina Genome Analyzer II (Volvox carteri) (GPL9922) SRA Volvox carteri
Volvox carteri		 unclassified source_name:Phosphate starvation title:Small RNAs from Volvox carteri under sulphate starvation description:VCA2 Total RNA was submitted to Illumina (Hayward, CA, http://www.illumina.com) for small RNA library construction using approaches described in (Lu et al., 2007) with minor modifications. Low molecular weight RNA was gel-sized in the ~18-33 nt range. The small RNA library was sequenced with the Sequencing-by-synthesis (SBS) technology by Illumina.
14 GSM803799 Small RNAs from Volvox carteri under phosphate starvation 846,662 University of Delaware 2011-09-29 [HT Sequencing] Illumina Genome Analyzer II (Volvox carteri) (GPL9922) SRA Volvox carteri
Volvox carteri		 unclassified source_name:Sulphate starvation title:Small RNAs from Volvox carteri under phosphate starvation description:VCA3 Total RNA was submitted to Illumina (Hayward, CA, http://www.illumina.com) for small RNA library construction using approaches described in (Lu et al., 2007) with minor modifications. Low molecular weight RNA was gel-sized in the ~18-33 nt range. The small RNA library was sequenced with the Sequencing-by-synthesis (SBS) technology by Illumina.
15 GSM497276 Volvox_carteri_BS-Seq 0 University of California at Berkeley 2010-01-14 [HT Sequencing] Illumina Genome Analyzer II (Volvox carteri) (GPL9922) SRA Volvox carteri
Volvox carteri		 unclassified source_name:Mature colonies title:Volvox_carteri_BS-Seq description:Bisulfite sequencing
16 GSM497277 Volvox_carteri_RNA-Seq 0 University of California at Berkeley 2010-01-14 [HT Sequencing] Illumina Genome Analyzer II (Volvox carteri) (GPL9922) SRA Volvox carteri
Volvox carteri		 unclassified source_name:Mature colonies title:Volvox_carteri_RNA-Seq description:RNA sequencing
17 GSM458928 sRNA from grape tendrils 554,445 University of East Anglia 2009-10-05 [HT Sequencing] Illumina Genome Analyzer (Vitis vinifera) (GPL9396) SRA Vitis vinifera
Vitis vinifera		 unclassified source_name:Vitis vinifera cv. Pinot noir, clone ENTAV115, tendrils title:sRNA from grape tendrils description:Total endogenous small RNAs from the tendrils of Vitis vinifera cv. Pinot noir, clone ENTAV115
18 GSM647922 503_control 0 University of California, Riverside 2011-01-03 [HT Sequencing] Illumina Genome Analyzer (Vigna unguiculata) (GPL11377) SRA Vigna unguiculata
Vigna unguiculata		 unclassified source_name:adult plants title:503_control
19 GSM647923 503_drought 0 University of California, Riverside 2011-01-03 [HT Sequencing] Illumina Genome Analyzer (Vigna unguiculata) (GPL11377) SRA Vigna unguiculata
Vigna unguiculata		 unclassified source_name:adult plants title:503_drought
20 GSM647924 CB46_control 0 University of California, Riverside 2011-01-03 [HT Sequencing] Illumina Genome Analyzer (Vigna unguiculata) (GPL11377) SRA Vigna unguiculata
Vigna unguiculata		 unclassified source_name:adult plants title:CB46_control
1   |   2   |   3   |   4   |   5      »      [626]
DBCLS | Site Policies | Contact Us