| |
SAGE NlaIII (1,683) |
|
SAGE RsaI (3) |
|
SAGE Sau3A (54) |
|
MPSS (439) |
|
GeneChip (387,571) |
|
Tiling Array (22,136) |
|
cDNA Array (104,070) |
|
Oligo Array (246,081) |
|
Bead Array (111,089) |
|
Protein Array (5) |
|
Antibody (1,156) |
|
RT-PCR (4,464) |
|
HT-Seq (38,248) |
|
Other (7,261) |
|
All (924,376) |
|
|
|
|
| 1 |
GSM34304 |
JPP vs. j-MLN |
12,288 |
University of Minneosta |
2004-11-02 |
[RT-PCR] PorkChip 2,600 cDNA array (GPL1624) |
RNA |
Sus scrofa
 |
intestine |
pool of jejunal MLN JPP Pig1 |
| 2 |
GSM34305 |
JPP 2 vs. j-MLN |
12,288 |
University of Minneosta |
2004-11-02 |
[RT-PCR] PorkChip 2,600 cDNA array (GPL1624) |
RNA |
Sus scrofa
 |
intestine |
pool of jejunal MLN JPP Pig 2 |
| 3 |
GSM34306 |
JPP 3 vs. j-MLN |
12,288 |
University of Minneosta |
2004-11-02 |
[RT-PCR] PorkChip 2,600 cDNA array (GPL1624) |
RNA |
Sus scrofa
 |
intestine |
pool of jejunal MLN JPP Pig3 |
| 4 |
GSM34309 |
JPP 4 vs. j-MLN |
12,288 |
University of Minneosta |
2004-11-02 |
[RT-PCR] PorkChip 2,600 cDNA array (GPL1624) |
RNA |
Sus scrofa
 |
intestine |
pool of jejunal MLN JPP Pig4 |
| 5 |
GSM34312 |
JPP 2 dye-swap vs. j-MLN |
12,288 |
University of Minneosta |
2004-11-02 |
[RT-PCR] PorkChip 2,600 cDNA array (GPL1624) |
RNA |
Sus scrofa
 |
intestine |
JPP Pig2 pool of jejunal MLN |
| 6 |
GSM34318 |
JPP 4 dye-swap vs. j-MLN |
12,288 |
University of Minneosta |
2004-11-02 |
[RT-PCR] PorkChip 2,600 cDNA array (GPL1624) |
RNA |
Sus scrofa
 |
intestine |
JPP Pig4 pool of jejunal MLN |
| 7 |
GSM35207 |
Sub vs. Sub, 2ug |
12,288 |
University of Minnesota |
2004-11-12 |
[RT-PCR] PorkChip 2,600 cDNA array (GPL1624) |
RNA |
Sus scrofa
 |
pooled |
Porcine jejunal intestinal tissue was obtained from 5-9 week old Yorkshire pigs as described previously (Green et al., 2003). Jejunal segments containing a Peyer's patch were stripped of the underlying smooth muscle layer and stored in RNAlater (Ambion, Inc., Austin, TX) immediately or mounted in an Ussing flux chamber (Green et al., 2003). Treatments were added to the luminal side of the Ussing chamber in both the presence and absence of 50 µM cycloheximide and incubated for 3 hours. Stimulation conditions consisted of (1) log phase Salmonella choleraesuis vaccine strain SC-54 (Roof and Doitchinoff, 1995) at an initial bacterial concentration of 2.7 x 104 CFU/ml; (2) 1 µg/ml lipopolysaccharide and 50 ng/ml cholera toxin (CT+LPS); (3) 100 nM phorbol myristate acetate, 1 mM 8-bromo-cyclic AMP and 5 µg/ml concanavalin A (PBC); and (4) incubated with no stimulation (normal). After the 3 hour incubation, tissues were removed, the region of tissue containing the Peyer's patch was excised and was stored in RNAlater (Ambion, Inc., Austin, TX) at ÃÂ20¡C. RNA was isolated from all Peyer's patches using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA) and examined for quality using the RNA 6000 Nano LabChip Kit on an Agilent 2100 bioanalyzer system (Agilent Technologies, Palo Alto, CA). RNA from all normal tissues were pooled in equal amounts and used to create the normal tissue library. RNA from all immune stimulated tissues (Salmonella infection, CT+LPS, and PBC, with and without cycloheximide) were pooled in equal amounts and used to create the immune stimulated tissue library. Libraries were created in the pCMVÂ¥Sport 6 plasmid using the SuperScript Plasmid System with Gateway Technology (Invitrogen Corporation, Carlsbad, CA) with a modified Not I d(T) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGCCT17VN 3'). The subtracted library was created by combining the normal and immune stimulated libraries and by subtracting porcine fibroblast RNA. cRNA was created from each of the subtracted, normal, and immune stimulated libraries following the MAXIscript in vitro transcription kit protocol (Ambion Inc., Austin, TX). The above cRNA's (200 ng) or isolated total RNA (10 ug) were used as templates for the reverse transcription and amino allyl coupling reaction. Either the SuperScript Indirect cDNA Labeling System (Invitrogen Corporation, Carlsbad, CA) was used for the reverse transcription reaction and clean-up steps or a similar homemade procedure was performed. The microarray chips were incubated at 63¡C for 5 to 16 hours, washed, dried, and scanned using a ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified with QuantArray software version 3 (PerkinElmer, Boston, MA) using the adaptive method to calculate the mean spot intensity and mean background intensity. Keywords = jejunal Peyer's patch Keywords = pig Keywords = small intestine Lot batch = |
| 8 |
GSM35208 |
Sub vs. Sub, 500ng |
12,288 |
University of Minnesota |
2004-11-12 |
[RT-PCR] PorkChip 2,600 cDNA array (GPL1624) |
RNA |
Sus scrofa
 |
pooled |
Porcine jejunal intestinal tissue was obtained from 5-9 week old Yorkshire pigs as described previously (Green et al., 2003). Jejunal segments containing a Peyer's patch were stripped of the underlying smooth muscle layer and stored in RNAlater (Ambion, Inc., Austin, TX) immediately or mounted in an Ussing flux chamber (Green et al., 2003). Treatments were added to the luminal side of the Ussing chamber in both the presence and absence of 50 µM cycloheximide and incubated for 3 hours. Stimulation conditions consisted of (1) log phase Salmonella choleraesuis vaccine strain SC-54 (Roof and Doitchinoff, 1995) at an initial bacterial concentration of 2.7 x 104 CFU/ml; (2) 1 µg/ml lipopolysaccharide and 50 ng/ml cholera toxin (CT+LPS); (3) 100 nM phorbol myristate acetate, 1 mM 8-bromo-cyclic AMP and 5 µg/ml concanavalin A (PBC); and (4) incubated with no stimulation (normal). After the 3 hour incubation, tissues were removed, the region of tissue containing the Peyer's patch was excised and was stored in RNAlater (Ambion, Inc., Austin, TX) at ÃÂ20¡C. RNA was isolated from all Peyer's patches using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA) and examined for quality using the RNA 6000 Nano LabChip Kit on an Agilent 2100 bioanalyzer system (Agilent Technologies, Palo Alto, CA). RNA from all normal tissues were pooled in equal amounts and used to create the normal tissue library. RNA from all immune stimulated tissues (Salmonella infection, CT+LPS, and PBC, with and without cycloheximide) were pooled in equal amounts and used to create the immune stimulated tissue library. Libraries were created in the pCMVÂ¥Sport 6 plasmid using the SuperScript Plasmid System with Gateway Technology (Invitrogen Corporation, Carlsbad, CA) with a modified Not I d(T) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGCCT17VN 3'). The subtracted library was created by combining the normal and immune stimulated libraries and by subtracting porcine fibroblast RNA. cRNA was created from each of the subtracted, normal, and immune stimulated libraries following the MAXIscript in vitro transcription kit protocol (Ambion Inc., Austin, TX). The above cRNA's (200 ng) or isolated total RNA (10 ug) were used as templates for the reverse transcription and amino allyl coupling reaction. Either the SuperScript Indirect cDNA Labeling System (Invitrogen Corporation, Carlsbad, CA) was used for the reverse transcription reaction and clean-up steps or a similar homemade procedure was performed. The microarray chips were incubated at 63¡C for 5 to 16 hours, washed, dried, and scanned using a ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified with QuantArray software version 3 (PerkinElmer, Boston, MA) using the adaptive method to calculate the mean spot intensity and mean background intensity. Keywords = jejunal Peyer's patch Keywords = pig Keywords = small intestine Lot batch = |
| 9 |
GSM35209 |
Sub vs. Sub, 200 ng |
12,288 |
University of Minnesota |
2004-11-12 |
[RT-PCR] PorkChip 2,600 cDNA array (GPL1624) |
RNA |
Sus scrofa
 |
pooled |
Porcine jejunal intestinal tissue was obtained from 5-9 week old Yorkshire pigs as described previously (Green et al., 2003). Jejunal segments containing a Peyer's patch were stripped of the underlying smooth muscle layer and stored in RNAlater (Ambion, Inc., Austin, TX) immediately or mounted in an Ussing flux chamber (Green et al., 2003). Treatments were added to the luminal side of the Ussing chamber in both the presence and absence of 50 µM cycloheximide and incubated for 3 hours. Stimulation conditions consisted of (1) log phase Salmonella choleraesuis vaccine strain SC-54 (Roof and Doitchinoff, 1995) at an initial bacterial concentration of 2.7 x 104 CFU/ml; (2) 1 µg/ml lipopolysaccharide and 50 ng/ml cholera toxin (CT+LPS); (3) 100 nM phorbol myristate acetate, 1 mM 8-bromo-cyclic AMP and 5 µg/ml concanavalin A (PBC); and (4) incubated with no stimulation (normal). After the 3 hour incubation, tissues were removed, the region of tissue containing the Peyer's patch was excised and was stored in RNAlater (Ambion, Inc., Austin, TX) at ÃÂ20¡C. RNA was isolated from all Peyer's patches using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA) and examined for quality using the RNA 6000 Nano LabChip Kit on an Agilent 2100 bioanalyzer system (Agilent Technologies, Palo Alto, CA). RNA from all normal tissues were pooled in equal amounts and used to create the normal tissue library. RNA from all immune stimulated tissues (Salmonella infection, CT+LPS, and PBC, with and without cycloheximide) were pooled in equal amounts and used to create the immune stimulated tissue library. Libraries were created in the pCMVÂ¥Sport 6 plasmid using the SuperScript Plasmid System with Gateway Technology (Invitrogen Corporation, Carlsbad, CA) with a modified Not I d(T) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGCCT17VN 3'). The subtracted library was created by combining the normal and immune stimulated libraries and by subtracting porcine fibroblast RNA. cRNA was created from each of the subtracted, normal, and immune stimulated libraries following the MAXIscript in vitro transcription kit protocol (Ambion Inc., Austin, TX). The above cRNA's (200 ng) or isolated total RNA (10 ug) were used as templates for the reverse transcription and amino allyl coupling reaction. Either the SuperScript Indirect cDNA Labeling System (Invitrogen Corporation, Carlsbad, CA) was used for the reverse transcription reaction and clean-up steps or a similar homemade procedure was performed. The microarray chips were incubated at 63¡C for 5 to 16 hours, washed, dried, and scanned using a ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified with QuantArray software version 3 (PerkinElmer, Boston, MA) using the adaptive method to calculate the mean spot intensity and mean background intensity. Keywords = jejunal Peyer's patch Keywords = pig Keywords = small intestine Lot batch = |
| 10 |
GSM35210 |
Normal vs. Subtracted |
12,288 |
University of Minnesota |
2004-11-12 |
[RT-PCR] PorkChip 2,600 cDNA array (GPL1624) |
RNA |
Sus scrofa
 |
pooled |
Porcine jejunal intestinal tissue was obtained from 5-9 week old Yorkshire pigs as described previously (Green et al., 2003). Jejunal segments containing a Peyer's patch were stripped of the underlying smooth muscle layer and stored in RNAlater (Ambion, Inc., Austin, TX) immediately or mounted in an Ussing flux chamber (Green et al., 2003). Treatments were added to the luminal side of the Ussing chamber in both the presence and absence of 50 µM cycloheximide and incubated for 3 hours. Stimulation conditions consisted of (1) log phase Salmonella choleraesuis vaccine strain SC-54 (Roof and Doitchinoff, 1995) at an initial bacterial concentration of 2.7 x 104 CFU/ml; (2) 1 µg/ml lipopolysaccharide and 50 ng/ml cholera toxin (CT+LPS); (3) 100 nM phorbol myristate acetate, 1 mM 8-bromo-cyclic AMP and 5 µg/ml concanavalin A (PBC); and (4) incubated with no stimulation (normal). After the 3 hour incubation, tissues were removed, the region of tissue containing the Peyer's patch was excised and was stored in RNAlater (Ambion, Inc., Austin, TX) at ÃÂ20¡C. RNA was isolated from all Peyer's patches using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA) and examined for quality using the RNA 6000 Nano LabChip Kit on an Agilent 2100 bioanalyzer system (Agilent Technologies, Palo Alto, CA). RNA from all normal tissues were pooled in equal amounts and used to create the normal tissue library. RNA from all immune stimulated tissues (Salmonella infection, CT+LPS, and PBC, with and without cycloheximide) were pooled in equal amounts and used to create the immune stimulated tissue library. Libraries were created in the pCMVÂ¥Sport 6 plasmid using the SuperScript Plasmid System with Gateway Technology (Invitrogen Corporation, Carlsbad, CA) with a modified Not I d(T) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGCCT17VN 3'). The subtracted library was created by combining the normal and immune stimulated libraries and by subtracting porcine fibroblast RNA. cRNA was created from each of the subtracted, normal, and immune stimulated libraries following the MAXIscript in vitro transcription kit protocol (Ambion Inc., Austin, TX). The above cRNA's (200 ng) or isolated total RNA (10 ug) were used as templates for the reverse transcription and amino allyl coupling reaction. Either the SuperScript Indirect cDNA Labeling System (Invitrogen Corporation, Carlsbad, CA) was used for the reverse transcription reaction and clean-up steps or a similar homemade procedure was performed. The microarray chips were incubated at 63¡C for 5 to 16 hours, washed, dried, and scanned using a ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified with QuantArray software version 3 (PerkinElmer, Boston, MA) using the adaptive method to calculate the mean spot intensity and mean background intensity. Sample_dye_swap: Normal (Cy3)/subtracted (Cy5) Keywords = jejunal Peyer's patch Keywords = pig Keywords = small intestine Lot batch = |
| 11 |
GSM35211 |
Immune Stim. vs. Subtracted |
12,288 |
University of Minnesota |
2004-11-12 |
[RT-PCR] PorkChip 2,600 cDNA array (GPL1624) |
RNA |
Sus scrofa
 |
pooled |
Porcine jejunal intestinal tissue was obtained from 5-9 week old Yorkshire pigs as described previously (Green et al., 2003). Jejunal segments containing a Peyer's patch were stripped of the underlying smooth muscle layer and stored in RNAlater (Ambion, Inc., Austin, TX) immediately or mounted in an Ussing flux chamber (Green et al., 2003). Treatments were added to the luminal side of the Ussing chamber in both the presence and absence of 50 µM cycloheximide and incubated for 3 hours. Stimulation conditions consisted of (1) log phase Salmonella choleraesuis vaccine strain SC-54 (Roof and Doitchinoff, 1995) at an initial bacterial concentration of 2.7 x 104 CFU/ml; (2) 1 µg/ml lipopolysaccharide and 50 ng/ml cholera toxin (CT+LPS); (3) 100 nM phorbol myristate acetate, 1 mM 8-bromo-cyclic AMP and 5 µg/ml concanavalin A (PBC); and (4) incubated with no stimulation (normal). After the 3 hour incubation, tissues were removed, the region of tissue containing the Peyer's patch was excised and was stored in RNAlater (Ambion, Inc., Austin, TX) at ÃÂ20¡C. RNA was isolated from all Peyer's patches using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA) and examined for quality using the RNA 6000 Nano LabChip Kit on an Agilent 2100 bioanalyzer system (Agilent Technologies, Palo Alto, CA). RNA from all normal tissues were pooled in equal amounts and used to create the normal tissue library. RNA from all immune stimulated tissues (Salmonella infection, CT+LPS, and PBC, with and without cycloheximide) were pooled in equal amounts and used to create the immune stimulated tissue library. Libraries were created in the pCMVÂ¥Sport 6 plasmid using the SuperScript Plasmid System with Gateway Technology (Invitrogen Corporation, Carlsbad, CA) with a modified Not I d(T) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGCCT17VN 3'). The subtracted library was created by combining the normal and immune stimulated libraries and by subtracting porcine fibroblast RNA. cRNA was created from each of the subtracted, normal, and immune stimulated libraries following the MAXIscript in vitro transcription kit protocol (Ambion Inc., Austin, TX). The above cRNA's (200 ng) or isolated total RNA (10 ug) were used as templates for the reverse transcription and amino allyl coupling reaction. Either the SuperScript Indirect cDNA Labeling System (Invitrogen Corporation, Carlsbad, CA) was used for the reverse transcription reaction and clean-up steps or a similar homemade procedure was performed. The microarray chips were incubated at 63¡C for 5 to 16 hours, washed, dried, and scanned using a ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified with QuantArray software version 3 (PerkinElmer, Boston, MA) using the adaptive method to calculate the mean spot intensity and mean background intensity. Sample_dye_swap: Immune Stim. (Cy3)/ Subtracted (Cy5) Keywords = jejunal Peyer's patch Keywords = pig Keywords = small intestine Lot batch = |
| 12 |
GSM35212 |
Immune Stim. vs. Normal |
12,288 |
University of Minnesota |
2004-11-12 |
[RT-PCR] PorkChip 2,600 cDNA array (GPL1624) |
RNA |
Sus scrofa
 |
pooled |
Porcine jejunal intestinal tissue was obtained from 5-9 week old Yorkshire pigs as described previously (Green et al., 2003). Jejunal segments containing a Peyer's patch were stripped of the underlying smooth muscle layer and stored in RNAlater (Ambion, Inc., Austin, TX) immediately or mounted in an Ussing flux chamber (Green et al., 2003). Treatments were added to the luminal side of the Ussing chamber in both the presence and absence of 50 µM cycloheximide and incubated for 3 hours. Stimulation conditions consisted of (1) log phase Salmonella choleraesuis vaccine strain SC-54 (Roof and Doitchinoff, 1995) at an initial bacterial concentration of 2.7 x 104 CFU/ml; (2) 1 µg/ml lipopolysaccharide and 50 ng/ml cholera toxin (CT+LPS); (3) 100 nM phorbol myristate acetate, 1 mM 8-bromo-cyclic AMP and 5 µg/ml concanavalin A (PBC); and (4) incubated with no stimulation (normal). After the 3 hour incubation, tissues were removed, the region of tissue containing the Peyer's patch was excised and was stored in RNAlater (Ambion, Inc., Austin, TX) at ÃÂ20¡C. RNA was isolated from all Peyer's patches using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA) and examined for quality using the RNA 6000 Nano LabChip Kit on an Agilent 2100 bioanalyzer system (Agilent Technologies, Palo Alto, CA). RNA from all normal tissues were pooled in equal amounts and used to create the normal tissue library. RNA from all immune stimulated tissues (Salmonella infection, CT+LPS, and PBC, with and without cycloheximide) were pooled in equal amounts and used to create the immune stimulated tissue library. Libraries were created in the pCMVÂ¥Sport 6 plasmid using the SuperScript Plasmid System with Gateway Technology (Invitrogen Corporation, Carlsbad, CA) with a modified Not I d(T) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGCCT17VN 3'). The subtracted library was created by combining the normal and immune stimulated libraries and by subtracting porcine fibroblast RNA. cRNA was created from each of the subtracted, normal, and immune stimulated libraries following the MAXIscript in vitro transcription kit protocol (Ambion Inc., Austin, TX). The above cRNA's (200 ng) or isolated total RNA (10 ug) were used as templates for the reverse transcription and amino allyl coupling reaction. Either the SuperScript Indirect cDNA Labeling System (Invitrogen Corporation, Carlsbad, CA) was used for the reverse transcription reaction and clean-up steps or a similar homemade procedure was performed. The microarray chips were incubated at 63¡C for 5 to 16 hours, washed, dried, and scanned using a ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified with QuantArray software version 3 (PerkinElmer, Boston, MA) using the adaptive method to calculate the mean spot intensity and mean background intensity. Sample_dye_swap: Immune Stim. (Cy3)/ Normal (Cy5) Keywords = jejunal Peyer's patch Keywords = pig Keywords = small intestine Lot batch = |
| 13 |
GSM35213 |
Immune Stim. vs. Normal2 |
12,288 |
University of Minnesota |
2004-11-12 |
[RT-PCR] PorkChip 2,600 cDNA array (GPL1624) |
RNA |
Sus scrofa
 |
pooled |
Porcine jejunal intestinal tissue was obtained from 5-9 week old Yorkshire pigs as described previously (Green et al., 2003). Jejunal segments containing a Peyer's patch were stripped of the underlying smooth muscle layer and stored in RNAlater (Ambion, Inc., Austin, TX) immediately or mounted in an Ussing flux chamber (Green et al., 2003). Treatments were added to the luminal side of the Ussing chamber in both the presence and absence of 50 µM cycloheximide and incubated for 3 hours. Stimulation conditions consisted of (1) log phase Salmonella choleraesuis vaccine strain SC-54 (Roof and Doitchinoff, 1995) at an initial bacterial concentration of 2.7 x 104 CFU/ml; (2) 1 µg/ml lipopolysaccharide and 50 ng/ml cholera toxin (CT+LPS); (3) 100 nM phorbol myristate acetate, 1 mM 8-bromo-cyclic AMP and 5 µg/ml concanavalin A (PBC); and (4) incubated with no stimulation (normal). After the 3 hour incubation, tissues were removed, the region of tissue containing the Peyer's patch was excised and was stored in RNAlater (Ambion, Inc., Austin, TX) at ÃÂ20¡C. RNA was isolated from all Peyer's patches using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA) and examined for quality using the RNA 6000 Nano LabChip Kit on an Agilent 2100 bioanalyzer system (Agilent Technologies, Palo Alto, CA). RNA from all normal tissues were pooled in equal amounts and used to create the normal tissue library. RNA from all immune stimulated tissues (Salmonella infection, CT+LPS, and PBC, with and without cycloheximide) were pooled in equal amounts and used to create the immune stimulated tissue library. Libraries were created in the pCMVÂ¥Sport 6 plasmid using the SuperScript Plasmid System with Gateway Technology (Invitrogen Corporation, Carlsbad, CA) with a modified Not I d(T) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGCCT17VN 3'). The subtracted library was created by combining the normal and immune stimulated libraries and by subtracting porcine fibroblast RNA. cRNA was created from each of the subtracted, normal, and immune stimulated libraries following the MAXIscript in vitro transcription kit protocol (Ambion Inc., Austin, TX). The above cRNA's (200 ng) or isolated total RNA (10 ug) were used as templates for the reverse transcription and amino allyl coupling reaction. Either the SuperScript Indirect cDNA Labeling System (Invitrogen Corporation, Carlsbad, CA) was used for the reverse transcription reaction and clean-up steps or a similar homemade procedure was performed. The microarray chips were incubated at 63¡C for 5 to 16 hours, washed, dried, and scanned using a ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified with QuantArray software version 3 (PerkinElmer, Boston, MA) using the adaptive method to calculate the mean spot intensity and mean background intensity. Sample_dye_swap: Immune Stim. (Cy5)/ Normal (Cy3) Keywords = jejunal Peyer's patch Keywords = pig Keywords = small intestine Lot batch = |
| 14 |
GSM35214 |
Immune Stim. vs. Subtracted 2 |
12,288 |
University of Minnesota |
2004-11-12 |
[RT-PCR] PorkChip 2,600 cDNA array (GPL1624) |
RNA |
Sus scrofa
 |
pooled |
Porcine jejunal intestinal tissue was obtained from 5-9 week old Yorkshire pigs as described previously (Green et al., 2003). Jejunal segments containing a Peyer's patch were stripped of the underlying smooth muscle layer and stored in RNAlater (Ambion, Inc., Austin, TX) immediately or mounted in an Ussing flux chamber (Green et al., 2003). Treatments were added to the luminal side of the Ussing chamber in both the presence and absence of 50 µM cycloheximide and incubated for 3 hours. Stimulation conditions consisted of (1) log phase Salmonella choleraesuis vaccine strain SC-54 (Roof and Doitchinoff, 1995) at an initial bacterial concentration of 2.7 x 104 CFU/ml; (2) 1 µg/ml lipopolysaccharide and 50 ng/ml cholera toxin (CT+LPS); (3) 100 nM phorbol myristate acetate, 1 mM 8-bromo-cyclic AMP and 5 µg/ml concanavalin A (PBC); and (4) incubated with no stimulation (normal). After the 3 hour incubation, tissues were removed, the region of tissue containing the Peyer's patch was excised and was stored in RNAlater (Ambion, Inc., Austin, TX) at ÃÂ20¡C. RNA was isolated from all Peyer's patches using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA) and examined for quality using the RNA 6000 Nano LabChip Kit on an Agilent 2100 bioanalyzer system (Agilent Technologies, Palo Alto, CA). RNA from all normal tissues were pooled in equal amounts and used to create the normal tissue library. RNA from all immune stimulated tissues (Salmonella infection, CT+LPS, and PBC, with and without cycloheximide) were pooled in equal amounts and used to create the immune stimulated tissue library. Libraries were created in the pCMVÂ¥Sport 6 plasmid using the SuperScript Plasmid System with Gateway Technology (Invitrogen Corporation, Carlsbad, CA) with a modified Not I d(T) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGCCT17VN 3'). The subtracted library was created by combining the normal and immune stimulated libraries and by subtracting porcine fibroblast RNA. cRNA was created from each of the subtracted, normal, and immune stimulated libraries following the MAXIscript in vitro transcription kit protocol (Ambion Inc., Austin, TX). The above cRNA's (200 ng) or isolated total RNA (10 ug) were used as templates for the reverse transcription and amino allyl coupling reaction. Either the SuperScript Indirect cDNA Labeling System (Invitrogen Corporation, Carlsbad, CA) was used for the reverse transcription reaction and clean-up steps or a similar homemade procedure was performed. The microarray chips were incubated at 63¡C for 5 to 16 hours, washed, dried, and scanned using a ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified with QuantArray software version 3 (PerkinElmer, Boston, MA) using the adaptive method to calculate the mean spot intensity and mean background intensity. Sample_dye_swap: Immune Stim. (Cy5)/ Subtracted (Cy3) Keywords = jejunal Peyer's patch Keywords = pig Keywords = small intestine Lot batch = |
| 15 |
GSM35215 |
Normal vs. Subtracted 2 |
12,288 |
University of Minnesota |
2004-11-12 |
[RT-PCR] PorkChip 2,600 cDNA array (GPL1624) |
RNA |
Sus scrofa
 |
pooled |
Porcine jejunal intestinal tissue was obtained from 5-9 week old Yorkshire pigs as described previously (Green et al., 2003). Jejunal segments containing a Peyer's patch were stripped of the underlying smooth muscle layer and stored in RNAlater (Ambion, Inc., Austin, TX) immediately or mounted in an Ussing flux chamber (Green et al., 2003). Treatments were added to the luminal side of the Ussing chamber in both the presence and absence of 50 µM cycloheximide and incubated for 3 hours. Stimulation conditions consisted of (1) log phase Salmonella choleraesuis vaccine strain SC-54 (Roof and Doitchinoff, 1995) at an initial bacterial concentration of 2.7 x 104 CFU/ml; (2) 1 µg/ml lipopolysaccharide and 50 ng/ml cholera toxin (CT+LPS); (3) 100 nM phorbol myristate acetate, 1 mM 8-bromo-cyclic AMP and 5 µg/ml concanavalin A (PBC); and (4) incubated with no stimulation (normal). After the 3 hour incubation, tissues were removed, the region of tissue containing the Peyer's patch was excised and was stored in RNAlater (Ambion, Inc., Austin, TX) at ÃÂ20¡C. RNA was isolated from all Peyer's patches using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA) and examined for quality using the RNA 6000 Nano LabChip Kit on an Agilent 2100 bioanalyzer system (Agilent Technologies, Palo Alto, CA). RNA from all normal tissues were pooled in equal amounts and used to create the normal tissue library. RNA from all immune stimulated tissues (Salmonella infection, CT+LPS, and PBC, with and without cycloheximide) were pooled in equal amounts and used to create the immune stimulated tissue library. Libraries were created in the pCMVÂ¥Sport 6 plasmid using the SuperScript Plasmid System with Gateway Technology (Invitrogen Corporation, Carlsbad, CA) with a modified Not I d(T) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGCCT17VN 3'). The subtracted library was created by combining the normal and immune stimulated libraries and by subtracting porcine fibroblast RNA. cRNA was created from each of the subtracted, normal, and immune stimulated libraries following the MAXIscript in vitro transcription kit protocol (Ambion Inc., Austin, TX). The above cRNA's (200 ng) or isolated total RNA (10 ug) were used as templates for the reverse transcription and amino allyl coupling reaction. Either the SuperScript Indirect cDNA Labeling System (Invitrogen Corporation, Carlsbad, CA) was used for the reverse transcription reaction and clean-up steps or a similar homemade procedure was performed. The microarray chips were incubated at 63¡C for 5 to 16 hours, washed, dried, and scanned using a ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified with QuantArray software version 3 (PerkinElmer, Boston, MA) using the adaptive method to calculate the mean spot intensity and mean background intensity. Sample_dye_swap: Normal (Cy5)/ Subtracted (Cy3) Keywords = jejunal Peyer's patch Keywords = pig Keywords = small intestine Lot batch = |
| 16 |
GSM604832 |
qRT-PCR on Staphylococcus aureus strain US300 |
2,647 |
J Craig Venter Institute |
2010-10-05 |
[RT-PCR] PFGRC Staphylococcus_aureus_full_genome_RT-PCR (GPL10963) |
RNA |
Staphylococcus aureus
 |
lung |
Staphylococcus aureus strain USA300 during mouse lung infection |
| 17 |
GSM604850 |
qRT-PCR on Staphylococcus aureus strain TB15 |
2,647 |
J Craig Venter Institute |
2010-10-05 |
[RT-PCR] PFGRC Staphylococcus_aureus_full_genome_RT-PCR (GPL10963) |
RNA |
Staphylococcus aureus
 |
lung |
Staphylococcus aureus strain TB15 during mouse lung infection |
| 18 |
GSM605598 |
qRT-PCR on Staphylococcus aureus strain TB15 in liver |
2,647 |
J Craig Venter Institute |
2010-10-06 |
[RT-PCR] PFGRC Staphylococcus_aureus_full_genome_RT-PCR (GPL10963) |
RNA |
Staphylococcus aureus
 |
liver/hepato |
Staphylococcus aureus strain TB15 during mouse liver infection |
| 19 |
GSM605599 |
qRT-PCR on Staphylococcus aureus strain US300 in liver |
2,647 |
J Craig Venter Institute |
2010-10-06 |
[RT-PCR] PFGRC Staphylococcus_aureus_full_genome_RT-PCR (GPL10963) |
RNA |
Staphylococcus aureus
 |
liver/hepato |
Staphylococcus aureus strain US300 during mouse liver infection |
| 20 |
GSM605604 |
qRT-PCR on Staphylococcus aureus strain TB15 in kidney |
2,647 |
J Craig Venter Institute |
2010-10-06 |
[RT-PCR] PFGRC Staphylococcus_aureus_full_genome_RT-PCR (GPL10963) |
RNA |
Staphylococcus aureus
 |
kidney |
Staphylococcus aureus strain TB-15 during mouse kidney infection |
|
|
|